ID: 1154010000

View in Genome Browser
Species Human (GRCh38)
Location 18:10565956-10565978
Sequence CTGGCTGAACAAAGGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154009993_1154010000 28 Left 1154009993 18:10565905-10565927 CCTTGTGACCCAGCAAACTCCTT No data
Right 1154010000 18:10565956-10565978 CTGGCTGAACAAAGGGAAGTAGG No data
1154009991_1154010000 30 Left 1154009991 18:10565903-10565925 CCCCTTGTGACCCAGCAAACTCC No data
Right 1154010000 18:10565956-10565978 CTGGCTGAACAAAGGGAAGTAGG No data
1154009995_1154010000 19 Left 1154009995 18:10565914-10565936 CCAGCAAACTCCTTCTAATAAAG No data
Right 1154010000 18:10565956-10565978 CTGGCTGAACAAAGGGAAGTAGG No data
1154009992_1154010000 29 Left 1154009992 18:10565904-10565926 CCCTTGTGACCCAGCAAACTCCT No data
Right 1154010000 18:10565956-10565978 CTGGCTGAACAAAGGGAAGTAGG No data
1154009994_1154010000 20 Left 1154009994 18:10565913-10565935 CCCAGCAAACTCCTTCTAATAAA No data
Right 1154010000 18:10565956-10565978 CTGGCTGAACAAAGGGAAGTAGG No data
1154009996_1154010000 9 Left 1154009996 18:10565924-10565946 CCTTCTAATAAAGTGAGCTCAGA No data
Right 1154010000 18:10565956-10565978 CTGGCTGAACAAAGGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154010000 Original CRISPR CTGGCTGAACAAAGGGAAGT AGG Intergenic
No off target data available for this crispr