ID: 1154014496

View in Genome Browser
Species Human (GRCh38)
Location 18:10604401-10604423
Sequence CCGTGGGTGCAGCTCTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154014496_1154014499 -10 Left 1154014496 18:10604401-10604423 CCTGGGGAGAGCTGCACCCACGG No data
Right 1154014499 18:10604414-10604436 GCACCCACGGACATCCTGCAGGG No data
1154014496_1154014502 -6 Left 1154014496 18:10604401-10604423 CCTGGGGAGAGCTGCACCCACGG No data
Right 1154014502 18:10604418-10604440 CCACGGACATCCTGCAGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154014496 Original CRISPR CCGTGGGTGCAGCTCTCCCC AGG (reversed) Intergenic
No off target data available for this crispr