ID: 1154018339

View in Genome Browser
Species Human (GRCh38)
Location 18:10639618-10639640
Sequence CTCCAGAAAGGGACATTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154018339_1154018350 24 Left 1154018339 18:10639618-10639640 CCCCCAAATGTCCCTTTCTGGAG No data
Right 1154018350 18:10639665-10639687 CAACATGTCCACACACACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154018339 Original CRISPR CTCCAGAAAGGGACATTTGG GGG (reversed) Intergenic
No off target data available for this crispr