ID: 1154023924

View in Genome Browser
Species Human (GRCh38)
Location 18:10689034-10689056
Sequence CAAAATACCCTCCTTGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 268}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154023924_1154023926 26 Left 1154023924 18:10689034-10689056 CCTTTTTCAAGGAGGGTATTTTG 0: 1
1: 0
2: 0
3: 21
4: 268
Right 1154023926 18:10689083-10689105 CACCCCAGCTAATGTTTTTTGGG 0: 1
1: 0
2: 2
3: 19
4: 209
1154023924_1154023925 25 Left 1154023924 18:10689034-10689056 CCTTTTTCAAGGAGGGTATTTTG 0: 1
1: 0
2: 0
3: 21
4: 268
Right 1154023925 18:10689082-10689104 TCACCCCAGCTAATGTTTTTTGG 0: 1
1: 0
2: 0
3: 11
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154023924 Original CRISPR CAAAATACCCTCCTTGAAAA AGG (reversed) Intronic
906654447 1:47537485-47537507 CAAAATACCTTCCATGAAGGGGG - Intergenic
906822009 1:48939753-48939775 CAGAATGCCCTCTTTGAAGAAGG - Intronic
908484921 1:64581865-64581887 TAAAATACCTTGCTGGAAAAAGG - Intronic
910229617 1:84972880-84972902 CAAAATACCATCACTGAAACTGG - Intronic
911969484 1:104413066-104413088 CAAATTACTCTCATGGAAAATGG - Intergenic
912435716 1:109659706-109659728 CAACATACACTCCTTCAACAGGG - Intronic
912695526 1:111838954-111838976 AAAAATACCCTACTAGGAAAAGG + Intronic
912963784 1:114219214-114219236 CAAAATAAGCTGCTTGAAAAGGG + Intergenic
915402801 1:155636135-155636157 CAAGATAAATTCCTTGAAAATGG + Intergenic
915965286 1:160301888-160301910 CAAAATTCCTTCATAGAAAAGGG + Intronic
916002127 1:160627057-160627079 CCAAATACCATCACTGAAAATGG - Intronic
917078004 1:171226104-171226126 TAAAATGCCCTCCTTTAAAGAGG + Intergenic
917465846 1:175275479-175275501 CAAAAAGCACTCCTTGAATATGG + Intergenic
920303797 1:205006049-205006071 CAAACCAACCTCCTTGCAAAAGG + Intronic
921788048 1:219256399-219256421 CAAATTAGCCTTCTGGAAAAAGG - Intergenic
921948503 1:220905587-220905609 CAAAATTCCATCACTGAAAAAGG + Intergenic
924393385 1:243588802-243588824 CAAAAAAACCTCCTTGATATTGG + Intronic
924567756 1:245212247-245212269 CCAATTACCCACCTTTAAAATGG - Intronic
924907905 1:248476022-248476044 CAAATTACCCAACTTAAAAATGG - Intergenic
924916204 1:248572060-248572082 CAAATTACCCAACTTAAAAATGG + Intergenic
1063963131 10:11323838-11323860 CAAAATACCTTTTTTAAAAATGG - Intronic
1063996642 10:11626148-11626170 CAAAATACCCTCCATGTATAGGG + Intergenic
1065549830 10:26860004-26860026 AAAAAAACCCGACTTGAAAATGG + Intronic
1065616021 10:27524448-27524470 TAAAATAACCTTCATGAAAAAGG - Intronic
1065864833 10:29905513-29905535 CAAAAAATCCTCCTTAATAATGG - Intergenic
1065932962 10:30495579-30495601 CAAAAGTCCCTTCTTGAAGATGG + Intergenic
1067018591 10:42775832-42775854 TAAAATGCCCTCCTTGAGGAGGG - Intergenic
1067495088 10:46754406-46754428 CAAAATGCCCTCCTGGAAGCTGG - Intergenic
1067543199 10:47172249-47172271 CATTTTAGCCTCCTTGAAAATGG - Intergenic
1067599567 10:47585990-47586012 CAAAATGCCCTCCTGGAAGCTGG + Intergenic
1068027443 10:51664640-51664662 TAAGATACCCTCTTTGAAAATGG + Intronic
1068098997 10:52528634-52528656 AAAAAAACCCTCCTAGAAATTGG - Intergenic
1068868148 10:61916564-61916586 CAAATTACCCTCCCGCAAAATGG - Intronic
1069646938 10:70006938-70006960 CACAAAACACTCCTTGAAGAGGG + Intergenic
1070252108 10:74782074-74782096 CAAAATGCACTCCTTGAATATGG + Intergenic
1071651097 10:87393874-87393896 CAAAATGCCCTCCTGGAAGCTGG + Intergenic
1072652195 10:97304401-97304423 CAAAACAAACTCCATGAAAATGG - Intergenic
1076584771 10:131538236-131538258 CAAATGACCCTACTTTAAAAAGG - Intergenic
1079276048 11:19038691-19038713 CAAAATGCTCACCTTGAACATGG - Intergenic
1080868606 11:36216556-36216578 CAAAATCCTCACCTTTAAAATGG - Intronic
1080902837 11:36511615-36511637 CAAAATACAATCTTTTAAAAGGG - Intronic
1081942628 11:46956631-46956653 GAAAATGGCCTCCTCGAAAAAGG - Intronic
1082647035 11:55739581-55739603 CAATCTACCCTTCTTGCAAAGGG + Intergenic
1083024500 11:59538652-59538674 AAAAATAACCCCATTGAAAATGG + Intergenic
1084459782 11:69290173-69290195 GAAAACACCCTACTTGTAAAAGG + Intergenic
1087595598 11:100250790-100250812 CAATATACCCTTCTTTAAGATGG + Intronic
1088342517 11:108784770-108784792 GAAAATACCCTGCTTGACACTGG - Intronic
1089904316 11:122022686-122022708 CAAATTACTCTCCTAGTAAATGG - Intergenic
1089917517 11:122172753-122172775 CTAAATAAACTACTTGAAAAAGG + Intergenic
1098381354 12:69873002-69873024 CAACATATCCTCCATGAATAAGG - Intronic
1101341335 12:103844164-103844186 CAAAATGTGCTCCTGGAAAAGGG - Exonic
1101546426 12:105717707-105717729 AAAAATAACCTCCTTCAAAAAGG - Intergenic
1101974545 12:109345268-109345290 CAAAGAACCCATCTTGAAAATGG + Intergenic
1103844365 12:123891235-123891257 CAAATTTCCCTCCTTTATAAGGG + Intronic
1104092572 12:125527991-125528013 CAAAAACCGCTTCTTGAAAAGGG + Intronic
1104507920 12:129350198-129350220 CAAAACACACTCCTTGAATATGG + Intronic
1107413479 13:40178899-40178921 CAAAATACCCTCCTAGCTACTGG + Intergenic
1107485085 13:40818785-40818807 AAAAATACCCTTCTTGACATTGG + Intergenic
1107755265 13:43614762-43614784 TAACATACCCTCATTGGAAATGG - Intronic
1108121497 13:47192739-47192761 CAAAATACCTTTATAGAAAAGGG - Intergenic
1108711112 13:53033365-53033387 CAAATTAACATCCTTCAAAATGG - Intronic
1109239906 13:59873281-59873303 CAAAATACCCTGAATGCAAATGG + Intronic
1109703350 13:66056208-66056230 TATAATACCCTGGTTGAAAAGGG - Intergenic
1112347291 13:98600832-98600854 AAAAATACCCCCCTCAAAAAAGG + Intergenic
1114241577 14:20873420-20873442 TAAAATAACCTCCTTCAGAAGGG + Intergenic
1116495528 14:45555171-45555193 CTGATTACCCTCCTGGAAAAGGG - Intergenic
1116700154 14:48230904-48230926 CAAAATGCCCTACATGTAAAAGG + Intergenic
1116844127 14:49848916-49848938 AAAAATCCACTCCTTGACAAAGG + Intronic
1117647746 14:57869814-57869836 CAAAACAACTTCCCTGAAAATGG - Intronic
1117893749 14:60455396-60455418 CAAAATTCCCTACTGTAAAATGG - Intronic
1118113535 14:62749557-62749579 CAAAACACACTTCTTGAATATGG - Intronic
1120299314 14:82685908-82685930 AAAAATAACATTCTTGAAAATGG + Intergenic
1121359401 14:93242752-93242774 CAAAATATCCACCTTGCGAAGGG + Exonic
1121557554 14:94849791-94849813 CAAAAGGCCCACCTTTAAAATGG - Intergenic
1121610779 14:95277447-95277469 CAAAATTCCCACCTTCCAAATGG - Intronic
1121658242 14:95614404-95614426 CACCATACTATCCTTGAAAAGGG - Intergenic
1123510388 15:20992862-20992884 AAAAAAACTCTCCTGGAAAATGG - Intergenic
1123567603 15:21566611-21566633 AAAAAAACTCTCCTGGAAAATGG - Intergenic
1123603864 15:22003904-22003926 AAAAAAACTCTCCTGGAAAATGG - Intergenic
1123699657 15:22904762-22904784 CAAATTACGCTCGTAGAAAAAGG + Intronic
1125321167 15:38490806-38490828 CAAAATAACTATCTTGAAAATGG - Intronic
1126699907 15:51358320-51358342 CAAGATAAATTCCTTGAAAATGG - Intronic
1126929240 15:53629607-53629629 GAAAATATGCTCCTTCAAAAAGG + Intronic
1127560900 15:60134973-60134995 AAAATTCCCCTCCTAGAAAATGG - Intergenic
1129439448 15:75569713-75569735 GAAAAGACCCTCCTTTAGAAAGG - Intronic
1132409966 15:101569263-101569285 CAAAGTACGCTCCTTGAATCGGG + Intergenic
1202975966 15_KI270727v1_random:293706-293728 AAAAAAACTCTCCTGGAAAATGG - Intergenic
1133724430 16:8524219-8524241 TAGAAAACCCTCCTTAAAAATGG + Intergenic
1133731960 16:8585696-8585718 CATTATATCCTCCATGAAAAAGG - Intronic
1140044954 16:71434332-71434354 CCAAATACCCTCCTTCAGGAAGG + Intergenic
1140122274 16:72093942-72093964 CAAAATCCACACCTTGAAAGCGG - Exonic
1140996512 16:80265004-80265026 CACAATACCATCCTTGGAAAGGG + Intergenic
1141051992 16:80775441-80775463 CAACCCACCCCCCTTGAAAAAGG - Intronic
1141383388 16:83596497-83596519 CAAAATTTCCTCCTGGAGAAAGG + Intronic
1147838590 17:43353775-43353797 CAAAATGCACTCCTTAAATATGG - Intergenic
1149000350 17:51751079-51751101 CAGAATTTCCTCCATGAAAATGG + Intronic
1150504524 17:65684401-65684423 CAAAATTCCCTGCTTCAAACTGG - Intronic
1154023924 18:10689034-10689056 CAAAATACCCTCCTTGAAAAAGG - Intronic
1155570786 18:27191026-27191048 CAAAATCCCTTCCCTCAAAAAGG - Intergenic
1158199535 18:54924506-54924528 CTCAATTCCCTCCTTCAAAAGGG - Intronic
1158794251 18:60823457-60823479 CAAAATAATCCCCTTAAAAATGG + Intergenic
1158873747 18:61713222-61713244 CAAAATGCACTCCTTGAATATGG + Intergenic
1159300162 18:66553466-66553488 CAAGAAACCCTAATTGAAAAAGG + Intronic
1159642266 18:70877081-70877103 CAAATCAGCCTCCCTGAAAATGG - Intergenic
1163302390 19:16456212-16456234 CAAAAAACCCTCCTGAAAAAGGG + Intronic
1164418476 19:28066514-28066536 CAAAATAATCTCTTTAAAAATGG - Intergenic
1164467454 19:28499949-28499971 CAAAAACCCCTCCTTAAGAATGG + Intergenic
1165227147 19:34362970-34362992 CAAAATAACCTACTAGAAAAAGG + Intronic
1166248862 19:41551776-41551798 GAAAATGGCCTCCTTGAAGACGG + Intronic
925872558 2:8283834-8283856 CAAATCACCCACCTTTAAAAAGG - Intergenic
926040679 2:9670437-9670459 CAAAAGGCCTTCCTTGTAAAGGG + Intergenic
926468559 2:13223172-13223194 CAACATACACACCTTGAAAATGG - Intergenic
926666257 2:15527069-15527091 CAAAATACCCTTCTTTTAAAAGG + Intronic
927305405 2:21566113-21566135 CAAAATACTCTCATTGTAATTGG + Intergenic
929173995 2:38959190-38959212 CCAAAAACCCTCCATGAAATTGG + Intronic
930046033 2:47174150-47174172 CAACATATGCTCATTGAAAACGG - Intronic
930445400 2:51464638-51464660 CAAATTATTATCCTTGAAAAGGG - Intergenic
930678894 2:54234221-54234243 CAAAACACTCTCATTGTAAACGG + Intronic
930734860 2:54767085-54767107 AAAATTACCCTCCTTGAATGAGG + Intronic
931328450 2:61253523-61253545 CCAACTACCCTTCTTGAAATTGG + Intronic
932859125 2:75270302-75270324 CAAAATAATCTCATTAAAAATGG - Intergenic
937060767 2:118978990-118979012 CAATTTACTCTCCTAGAAAAGGG + Intronic
938188995 2:129257394-129257416 CAAAATTCCCTCACTGAAAGAGG + Intergenic
939059870 2:137408824-137408846 CAGAAAACCATCCTTGAACATGG - Intronic
939472669 2:142644345-142644367 CAAAATACACTGCTTAGAAATGG - Intergenic
940195136 2:151085814-151085836 CTAAATACCTTCCCTGAAGAAGG - Intergenic
941217811 2:162735885-162735907 CATAATATGCTCCTTGAGAAGGG + Intronic
941771251 2:169348503-169348525 CAAAAGGCCCTCTTTGAAGAGGG - Intronic
942768092 2:179481258-179481280 CAAAATATACTCATTGAAATTGG + Intronic
942885048 2:180912815-180912837 AAAAATATGCACCTTGAAAAAGG + Intergenic
943270638 2:185798110-185798132 CAAAATCTCCTGCTTTAAAATGG - Intronic
943656412 2:190513375-190513397 CAAAGCAACCTCATTGAAAACGG - Intronic
944918730 2:204388609-204388631 CAAAATAGCCTCTTTTAAGAAGG + Intergenic
944999487 2:205332853-205332875 AATAATACCCTCCTTGTATATGG - Intronic
945109370 2:206347918-206347940 CAAATTAATCTCCTTGAAAGAGG + Intergenic
946424048 2:219582827-219582849 CAAAATGCACTCCTTCAATATGG - Intergenic
946608877 2:221436873-221436895 AAAACTACCCTCGTTGAACATGG + Intronic
946894657 2:224310996-224311018 CAAAATGCCATCCTTCAGAAAGG + Intergenic
947330926 2:229028590-229028612 CAAAAAACCCAACTTAAAAATGG + Intronic
948760422 2:240186864-240186886 CACAATTCCTTCTTTGAAAAGGG + Intergenic
1168872978 20:1146651-1146673 CAAAATACTCTCCTTGACGTGGG - Intronic
1170724987 20:18918361-18918383 GAAAATATGCTCCTTGAAGATGG + Intergenic
1171028648 20:21655881-21655903 CAAAACGCACTCCTTGAATATGG + Intergenic
1171978998 20:31613554-31613576 CAAGATCTCCTCCTTTAAAAGGG - Intergenic
1173316435 20:41948921-41948943 AAAAATCCCCTCCATGGAAAGGG - Intergenic
1173360248 20:42337787-42337809 CAAAATACCAGCTTGGAAAATGG + Intronic
1173643418 20:44618928-44618950 CAAAATCCCTTCCCTAAAAATGG - Exonic
1174651902 20:52133730-52133752 CAAAAAGCCCTTCTTGAAGAAGG - Intronic
1174847003 20:53952068-53952090 AAAAATACCCACTTTGAGAATGG - Intronic
1177024354 21:15903926-15903948 GAAAATATACTCTTTGAAAAGGG + Intergenic
1177875797 21:26629945-26629967 CATAATACTTTCCCTGAAAAAGG + Intergenic
1178749993 21:35293419-35293441 GAAAATAAACTCCTAGAAAATGG + Intronic
1179039435 21:37789112-37789134 CAAAAAATTCTTCTTGAAAAAGG + Intronic
1179090028 21:38256218-38256240 CAGAATTCCATCCTTGAAGAAGG - Intronic
1181995603 22:26879136-26879158 GAAAAGACCCTCCATGAAAAGGG - Intergenic
1182011278 22:27002826-27002848 GAAAATAGCCTCCCTGGAAAAGG + Intergenic
1182467629 22:30527272-30527294 AAAAATACTTTCCTAGAAAATGG + Intronic
1182726887 22:32454593-32454615 CAATATTTCCTCCTTGAAAAGGG - Intronic
1185306607 22:50121134-50121156 AAAAAAACCCTCCTGGACAAAGG - Intronic
952574021 3:34752697-34752719 GAAAATACCCTTCTTGACATTGG + Intergenic
952798158 3:37261457-37261479 CACAAAACCCTAGTTGAAAATGG - Intronic
953445430 3:42960819-42960841 CAAAATACCCATCTTCACAAGGG - Intronic
953617381 3:44503291-44503313 CAGAATAGCTTCCTTGAAAAAGG - Intronic
955312408 3:57902310-57902332 AAAAATACCTTCTTAGAAAAAGG + Intronic
955541560 3:59982235-59982257 CAAAATAACATCCCTGAAGATGG + Intronic
955574411 3:60343968-60343990 CAAAATGCCATCCTTAAAATTGG - Intronic
956322395 3:68011467-68011489 AAAAATATCCTACTTTAAAATGG - Intronic
957739940 3:84252195-84252217 CAAAATGCGCTCCTTACAAATGG - Intergenic
960804563 3:121571107-121571129 CAATATACCTGCCTTGGAAAAGG - Intronic
962306829 3:134294942-134294964 CAAACTCTCATCCTTGAAAAAGG - Intergenic
963649132 3:147955502-147955524 ACAAGTCCCCTCCTTGAAAAAGG - Intergenic
964400671 3:156294734-156294756 CACAATTTCATCCTTGAAAATGG + Intronic
965132603 3:164720965-164720987 AAAAATAACCTCCTTGCAACAGG + Intergenic
965775050 3:172220353-172220375 CAAACAACCCTACTTAAAAATGG - Intronic
967102511 3:186227882-186227904 CAAAATACCCTTATGCAAAAGGG + Intronic
968536363 4:1132716-1132738 CAGAATATCCTCCTGGGAAATGG - Intergenic
970541473 4:17084638-17084660 CAAAATACCCTAATGAAAAATGG + Intergenic
970784032 4:19774619-19774641 AAAAATTTCCTCCATGAAAATGG + Intergenic
970810773 4:20091523-20091545 CAAAATACTCTTCTTCTAAATGG - Intergenic
972392748 4:38628278-38628300 CAAAGTAGTCTTCTTGAAAAAGG - Intergenic
972806340 4:42532611-42532633 CAAAATACCAATGTTGAAAATGG + Intronic
973007903 4:45035708-45035730 CAAAGTACCCTCTCTGAATAAGG - Intergenic
973967535 4:56179362-56179384 CAAAATTTTCTCCTTGCAAAAGG - Intronic
974169035 4:58242495-58242517 CCAGACACCCTCCTTGAAACTGG - Intergenic
974599669 4:64061270-64061292 CAAAATTTCATCTTTGAAAAAGG - Intergenic
974609580 4:64198875-64198897 TAAAATACCCTTGCTGAAAAGGG + Intergenic
976186917 4:82451495-82451517 TAAAATAGCTTCCTAGAAAATGG + Intronic
976411616 4:84720002-84720024 CAAAAGAACATCCTTTAAAAAGG + Intronic
977006732 4:91576220-91576242 CAAAATACCCTTCTTTTTAAAGG - Intronic
978573805 4:110168639-110168661 CAAAATATCACCTTTGAAAATGG + Intronic
978691982 4:111524695-111524717 GAAAATACCCTTCTTGACATTGG - Intergenic
979805598 4:124966774-124966796 CACAATAGCCTCCCTGCAAACGG + Intergenic
980908093 4:138969134-138969156 CAAAGTACCTGCCTTTAAAATGG + Intergenic
982336803 4:154248998-154249020 AGAAATACCCTTCTTGAAATTGG + Intronic
982383803 4:154778589-154778611 CAAAATACACCCCCTGACAAAGG - Intergenic
982669979 4:158308734-158308756 AAAAATAACCTCATTAAAAATGG - Intergenic
983639320 4:169929914-169929936 CAAAATACACTCCTTTGAACTGG - Intergenic
984409117 4:179372182-179372204 TATACTACCCTCCATGAAAAAGG - Intergenic
985137748 4:186804775-186804797 GAAAACACTCTCCCTGAAAACGG - Intergenic
987503747 5:18744810-18744832 CAAGATAAATTCCTTGAAAATGG + Intergenic
987587596 5:19876532-19876554 AAAAATTCCCTCCTGGGAAAAGG - Intronic
987846287 5:23291350-23291372 CAAAAAACCCTTCTAGAAATTGG - Intergenic
988746675 5:34146725-34146747 GAAAATACCCTTCTTGACAGTGG + Intergenic
989310467 5:40011121-40011143 CAAAATACCCTCTTTATCAAAGG - Intergenic
991643474 5:68777184-68777206 CAAAATATTCTCCTTGGAGAGGG - Intergenic
991723290 5:69514306-69514328 CAAGATTCACTCCTTGAAAATGG - Intronic
993897380 5:93553063-93553085 CTAAATAACCTATTTGAAAATGG + Intergenic
994505211 5:100634558-100634580 CAAAATACTTTCCTTTTAAAGGG + Intergenic
994635440 5:102340109-102340131 CAAAAGGCACTCCTTGAATATGG - Intergenic
995281302 5:110338701-110338723 CAAAAAACCCTTCTTGAATGTGG - Intronic
995593233 5:113721554-113721576 CAAAACACCCTCTTTGATATTGG + Intergenic
996143214 5:119940777-119940799 CAAAATAACTTTCCTGAAAATGG - Intergenic
996361980 5:122658695-122658717 CAAAATCCACACCTTTAAAAGGG + Intergenic
997886592 5:137635845-137635867 TAAAATACTCCCCTTGACAAAGG - Intronic
997958628 5:138301010-138301032 CTAAATACCCTTATTTAAAAAGG + Intronic
998201634 5:140129145-140129167 CAAAAAACCTTCCATGAGAATGG - Exonic
998325025 5:141272577-141272599 CAAAAGGACCTCCTTGAAGATGG - Intergenic
998586541 5:143433020-143433042 CCAAACATCCTCCTTTAAAATGG - Intronic
999405905 5:151306363-151306385 AAAGACACACTCCTTGAAAATGG - Intergenic
1004215862 6:13703488-13703510 CAAAATACCCTGCTGGTACAAGG - Intronic
1004691992 6:18000249-18000271 CAAAATAACCTGATTAAAAATGG + Intergenic
1004713193 6:18191899-18191921 CACTGTACCCACCTTGAAAAAGG + Intronic
1008234682 6:49029724-49029746 GAAAATACCCTCCTTTTATATGG + Intergenic
1008791556 6:55240790-55240812 CAAAAAACCTACCTTGAAACAGG - Intronic
1009190185 6:60620986-60621008 ACAAAGACACTCCTTGAAAAGGG - Intergenic
1010549440 6:77202818-77202840 CCAAATAGCCTCATTAAAAATGG + Intergenic
1010820895 6:80414371-80414393 GAAAATACCATCCTGGAAATAGG - Intergenic
1012571506 6:100735651-100735673 CATAATTCCATCCTAGAAAAAGG + Intronic
1012895750 6:104945582-104945604 CAAAATTCCTGCCTTAAAAAAGG - Intergenic
1014070154 6:117172319-117172341 AAAAATAACTTGCTTGAAAAAGG + Intergenic
1014653575 6:124071636-124071658 CAAAATAACCCCTTTAAAAATGG + Intronic
1015647247 6:135406460-135406482 CAAAATCCTCTTCTGGAAAATGG + Intronic
1015878225 6:137845486-137845508 CATTATGCACTCCTTGAAAACGG - Intergenic
1017687186 6:156925341-156925363 CAAAAAACCATTCTAGAAAAAGG - Intronic
1018083373 6:160277883-160277905 CAAAATACACTCCTCAAAACAGG + Intergenic
1018265139 6:162016385-162016407 CAAAATATCCTCTTTGAAAGGGG + Intronic
1018473401 6:164116733-164116755 CAAAATACCAACATTCAAAAGGG - Intergenic
1019097134 6:169591439-169591461 CCAAATACCCTACTTGGTAAGGG - Intronic
1020241592 7:6399338-6399360 TAAAATATTCTCCTGGAAAAAGG - Intronic
1022055867 7:26733925-26733947 GACAATCCCCTCCTTAAAAATGG + Intronic
1022334793 7:29412085-29412107 CACACTACCCTTCTTTAAAATGG + Intronic
1022781214 7:33586202-33586224 CCAAATAACCTCATTAAAAATGG + Intronic
1023413020 7:39906501-39906523 CAATATACCTTCCTCGAAACAGG - Intergenic
1023568577 7:41549361-41549383 CAAAATGCACTCCTTGAATATGG - Intergenic
1024081947 7:45863563-45863585 CTAAACACCCTCCTAGAAGAGGG - Intergenic
1027927960 7:84492069-84492091 GCACATACCCTTCTTGAAAATGG - Intronic
1028732201 7:94164441-94164463 CTAAATTCCTTCCTTGCAAAAGG - Intergenic
1029789346 7:102826217-102826239 GAAAAAACCCGCCTTGAAGATGG + Intronic
1030338189 7:108347968-108347990 AAATATACCCTCCTAGAACATGG - Intronic
1033101074 7:138472682-138472704 TAAAATACCCTGCTTCAAAAAGG - Intronic
1034132158 7:148729445-148729467 CCAGATTCCCTCCTTAAAAAGGG + Intronic
1034479404 7:151308120-151308142 CAAATTTCCCTTCTTTAAAAGGG - Intergenic
1037724592 8:21472826-21472848 CTAAATACCCTCCCTGAGCAAGG - Intergenic
1039115795 8:34090080-34090102 CAAAATAGACTCCTTGAATATGG + Intergenic
1039125086 8:34192088-34192110 AAAAACACCCCCCATGAAAAGGG - Intergenic
1039184402 8:34900547-34900569 CATAAGACCCTCCTTCCAAAAGG + Intergenic
1039296562 8:36162503-36162525 CAGAATACTCGCCTAGAAAATGG - Intergenic
1040453394 8:47571641-47571663 GAATATATCCTCCTTGAATAAGG - Intronic
1040698267 8:50028954-50028976 CAAAATATCCAATTTGAAAATGG - Intronic
1046689878 8:117270758-117270780 CGAATTACCCTGCTTGAAGATGG - Intergenic
1046845309 8:118908827-118908849 GAAAATAACCTGCTTGAGAAGGG + Intergenic
1047808263 8:128380921-128380943 CAAGATAAATTCCTTGAAAATGG + Intergenic
1048726009 8:137385806-137385828 CAATATACACTCACTGAAAAGGG + Intergenic
1050081919 9:1924413-1924435 CTAAATACCCTACATGAAACAGG - Intergenic
1051545411 9:18268973-18268995 CAAAATATCCACCTACAAAATGG + Intergenic
1051643225 9:19243014-19243036 CAAGATACCCCCCTTTAAATTGG - Intronic
1052963123 9:34317934-34317956 GAATATATCCTCCTTGAATAAGG + Intronic
1055499262 9:76887035-76887057 CAAAAGACGCTCCTTCATAAGGG - Intronic
1057888429 9:98849302-98849324 CAAAATACCCTATTTTCAAAGGG + Exonic
1058015350 9:100025886-100025908 CACTACACCCTGCTTGAAAATGG - Intronic
1058236096 9:102491870-102491892 GAAAATACCCTTCTTGACATTGG + Intergenic
1058628495 9:106960710-106960732 TTAAAAACCCTCCTTGAAACAGG - Intronic
1060146382 9:121256097-121256119 CAAAATATCTTCCTCTAAAAAGG - Intronic
1186037580 X:5441506-5441528 CAAAAAATCCTACTTGAAAAAGG + Intergenic
1186397730 X:9226511-9226533 CAAAATGCTCTCTCTGAAAAAGG + Intergenic
1186781636 X:12917974-12917996 CAGCATACCATCCTTCAAAAAGG + Intronic
1188124003 X:26345415-26345437 CAAAATTCCTGCTTTGAAAAAGG + Intergenic
1188780864 X:34282919-34282941 CAAAACCACCTCCTTCAAAATGG - Intergenic
1188838201 X:34984606-34984628 CAAAAGCCACTCCTTGAACATGG - Intergenic
1190487903 X:50947850-50947872 GAAAATATCTTCCTTCAAAAAGG + Intergenic
1193432221 X:81422085-81422107 CAAAATATGCTCTTTGAAATAGG + Intergenic
1194242375 X:91468037-91468059 CCAAATAACCTCATTAAAAATGG - Intergenic
1194955693 X:100177606-100177628 CATAAATCCCTGCTTGAAAATGG + Intergenic
1195054702 X:101132813-101132835 CTAAATACCCTTCTTGACACTGG + Intronic
1195352039 X:104005237-104005259 CAAGAAAGCCTCCTTGGAAAAGG - Intergenic
1195669511 X:107457797-107457819 CATCATACCCTCCTTCATAAAGG + Intergenic
1196486134 X:116210091-116210113 CAAAATAACCTTATTAAAAATGG + Intergenic
1197470206 X:126857960-126857982 AAAAATACACTCCTTGCCAATGG + Intergenic
1197576714 X:128221649-128221671 CAAAATAACCTGATTAAAAATGG + Intergenic
1198890023 X:141383841-141383863 CAAAATACCCAATTTAAAAATGG + Intergenic