ID: 1154025142

View in Genome Browser
Species Human (GRCh38)
Location 18:10699750-10699772
Sequence AGCTTTTGGCAGATGGACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154025142 Original CRISPR AGCTTTTGGCAGATGGACTA AGG Intronic
906895520 1:49766078-49766100 AGCATTTGGCAGATGTACTCTGG - Intronic
907759313 1:57342415-57342437 TGCTTTTGGCAAATGCACTAGGG - Intronic
912881152 1:113415800-113415822 AGCTATTGGGAGAGGGAGTAAGG - Intronic
915570666 1:156743613-156743635 ACCCCTTGGCAGCTGGACTAGGG - Intronic
917156367 1:172003929-172003951 AGCTTGGTGCAGATGCACTATGG - Intronic
917204257 1:172553967-172553989 ATCTGTAGGCAGAAGGACTAAGG + Intronic
918510785 1:185311847-185311869 AGCATTTGGCAGAGGCTCTATGG - Intronic
918705519 1:187656875-187656897 AGCTTTTGTCAAATGGACAGAGG + Intergenic
921501402 1:215908210-215908232 GGGTTTTGGGAGATGAACTATGG - Intronic
924432469 1:244008688-244008710 AGCTTCTGGGAGATAGAATATGG - Intergenic
924685298 1:246283157-246283179 AGCTTTTGGGATCTGGACTCAGG + Intronic
1069236167 10:66077005-66077027 GGCATTTGGGAGATGGACGAAGG + Intronic
1069582923 10:69577562-69577584 AGCTCCTGGCAGATGAAATATGG - Intergenic
1069925059 10:71843864-71843886 TGCTTTTGGCAAATGTACCATGG + Intronic
1070940568 10:80342179-80342201 AGCTGTTAGCAGAAGGACCATGG - Intronic
1071010899 10:80939071-80939093 TGCTTTTGGCAAGTGCACTAAGG + Intergenic
1072225751 10:93367394-93367416 AGCTTTTGGCTGAAGGAGAAAGG + Intronic
1077446879 11:2598622-2598644 AGAATTTGGCAGATGTATTAGGG - Intronic
1080814721 11:35743876-35743898 ATTTTTTGGCAGATGGAATTAGG - Intronic
1083436175 11:62645205-62645227 TGCTTTTGGCAGGTGGACGTGGG - Intronic
1084895681 11:72266130-72266152 AGCTTGTGCCAGAAGGGCTAGGG + Intergenic
1089289178 11:117427480-117427502 AGCTTGTAGCAGATGGAATGAGG - Intergenic
1089710617 11:120311841-120311863 AGCTTTTGCAAGATGGGCAAAGG + Intronic
1090863010 11:130671469-130671491 AGATTTTGGCAGATGGCAAATGG - Intergenic
1091697181 12:2635644-2635666 CTCTTTTAGCAGATGGACTATGG + Intronic
1095096027 12:38149765-38149787 AGATCAGGGCAGATGGACTAGGG - Intergenic
1098812576 12:75114812-75114834 AGCTTTTGGAGAAAGGACTAAGG - Intronic
1100109859 12:91227150-91227172 AGCTTTGCCCAGATGGACAAAGG + Intergenic
1100938668 12:99700430-99700452 AGCCTTTGCCATATTGACTAAGG + Intronic
1102061530 12:109935786-109935808 AGCTTTTGAGAGATGGCCTTAGG - Intronic
1105541894 13:21322959-21322981 AGCTTTGTGCAGATGGACTTGGG + Intergenic
1106106131 13:26734986-26735008 TGCTTTTGGCACATTGACCATGG - Intergenic
1107068440 13:36243137-36243159 AGGTTTGGGCAGAGGGAGTAGGG - Intronic
1112791388 13:103006263-103006285 AGGTTGTGGCACATGTACTATGG + Intergenic
1114620127 14:24090827-24090849 AGCTTTAGGCAGATGGAGCAAGG - Intronic
1119105808 14:71922541-71922563 AGTTTTTGACAAATGTACTATGG - Intergenic
1121016854 14:90554199-90554221 AGCTGCTGGCAGATGGGCTGCGG - Intronic
1121109255 14:91301377-91301399 AGGTTTTGGCAGGTGGAGTCTGG - Intronic
1130239607 15:82174725-82174747 AGGGTTTGGCAGTGGGACTAAGG - Intronic
1131179821 15:90232140-90232162 AGCTAGTGGCAGATGGAGTTAGG + Intronic
1135619638 16:23944795-23944817 AGCTTTTGGAAGATTGACCTAGG - Intronic
1137879494 16:52031638-52031660 AGCTGCTGGAAGATGGACCAAGG + Intronic
1140811753 16:78585423-78585445 AGCTTTTGGGAGGTGGTCAAAGG - Intronic
1142090966 16:88209191-88209213 AGTGTTGGGGAGATGGACTAGGG - Intergenic
1142678459 17:1530777-1530799 ACCTTTTGGGAGATGGAAAAAGG + Intronic
1144390463 17:14788906-14788928 AGTTTTAGGCAGATTGACTTTGG - Intergenic
1145823973 17:27862673-27862695 GGCATTTGGCAGATGGACTGGGG + Intronic
1150138231 17:62707405-62707427 AGGGTTTGGCAGATGGGCAAGGG - Intronic
1151072056 17:71225823-71225845 TGCTTTTGGGAAATGGAATAAGG - Intergenic
1151186219 17:72365873-72365895 AGCTTCTGGCTGATGGAATATGG - Intergenic
1154025142 18:10699750-10699772 AGCTTTTGGCAGATGGACTAAGG + Intronic
1155252536 18:23966021-23966043 AGCTTTTGGCACCTGGAAAATGG - Intergenic
1155716087 18:28945507-28945529 AGCTTTTAGCAAAAGGACAAAGG - Intergenic
1156717056 18:40024156-40024178 AGCTGCTGGAAGATGGACTCTGG + Intergenic
1156997875 18:43489714-43489736 TGCTTTTGGCAGATAGGATAAGG + Intergenic
1159589018 18:70311372-70311394 GGCTTATGGGAGATGGATTAAGG + Intronic
1162351354 19:10151685-10151707 AGCTGGTGGCAGATGCACTGTGG - Intronic
1162611996 19:11763146-11763168 AGCTTTAAGCAGCTGGGCTAAGG + Intergenic
1165132029 19:33638875-33638897 AGCTCTTGCCTGATGGACCAGGG - Intronic
1167687030 19:50962836-50962858 AGCTGATGGAAGAGGGACTAAGG - Intronic
926801373 2:16663841-16663863 GGGTTTAGGCAGCTGGACTAAGG + Intronic
927375969 2:22414833-22414855 TGCTGTTGGGAGATGGAGTATGG - Intergenic
928589047 2:32794684-32794706 ACCTTTAGATAGATGGACTAAGG + Intronic
930502241 2:52235941-52235963 AGCTTTTGGTTCATGGACTATGG - Intergenic
932369813 2:71177664-71177686 AGTGTTTGCCAGAGGGACTATGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
939486164 2:142813911-142813933 ATCTTTTGGCTGAAGGAATATGG - Intergenic
945772439 2:214061015-214061037 AGCTTTTGGGAAATGGCATATGG + Intronic
947794743 2:232887210-232887232 AGCTTTTGACAGCTGTGCTAGGG - Intronic
1169286647 20:4313753-4313775 AGCTATTGGGAGTTGGACTGTGG + Intergenic
1171366377 20:24627585-24627607 AGCCTTTGAAAGATGCACTACGG - Intronic
1173059101 20:39644903-39644925 AGCTTTTAGCAGATTCTCTAAGG + Intergenic
1174017961 20:47503961-47503983 AGCTTTTGGCATATAGAAGATGG + Intronic
1176720005 21:10385070-10385092 AGCTTCTGGTAGGTGGACCATGG - Intergenic
1176720024 21:10385148-10385170 AGCTTCTGGTAGGTGGACCATGG - Intergenic
1176965599 21:15208574-15208596 AGCTTTGGGCAGCAGGACTCAGG + Intergenic
1177033852 21:16016814-16016836 AGCTGTAGGTAGATGGACAAGGG + Intergenic
1177706118 21:24707454-24707476 AGATTTTTGTAGATGAACTAAGG - Intergenic
1179226379 21:39456724-39456746 AACTTCTGGCATATGGACTCTGG - Intronic
1179974868 21:44858948-44858970 AACATTTGGCAGACGTACTAAGG + Intronic
1182252072 22:29008756-29008778 AGCTTTAACCAGAAGGACTAAGG + Intronic
1182441758 22:30368721-30368743 AGCTTTTTGCAGATGCAGGAGGG - Intronic
1184038076 22:41927959-41927981 AGTGTTTGCCAGATGGACTGAGG + Intergenic
1184251122 22:43260927-43260949 TGCTTGTGTCAGATGTACTATGG + Intronic
949661196 3:6280970-6280992 AGCTTTTGGGAGCTGGACATTGG + Intergenic
951717708 3:25665832-25665854 AGTCTTTGGCAGATGGAAGATGG + Intergenic
952529312 3:34247017-34247039 AGCTAGTGGAAGATGGACAAGGG - Intergenic
955231020 3:57098729-57098751 AAGTTTTTGCAGAGGGACTAGGG - Intronic
955411215 3:58656744-58656766 AGCCTTTGGCAGTTGAACTTTGG - Intronic
961392372 3:126560375-126560397 AGCTTTAGCTAGATTGACTAAGG - Intergenic
962640744 3:137383540-137383562 AGCTGTGGACAGATGGACTATGG + Intergenic
965487410 3:169294773-169294795 AGATTTTGGAAGAAGGACTGAGG - Intronic
972707533 4:41559928-41559950 AATTTTTGGCATATGGACTTGGG - Intronic
975603825 4:76132262-76132284 ACCTTTGGGTAGATGGATTATGG + Intronic
977088376 4:92635002-92635024 AGCTTTTGGCACAGTGACTGTGG - Intronic
978264073 4:106801243-106801265 AGCTTAAGGCAGATAGACTCAGG + Intergenic
979107865 4:116710474-116710496 AGCCTTTTGCAGATGTAATAGGG + Intergenic
979402757 4:120270001-120270023 AGCTCTTTTCAGATAGACTAAGG - Intergenic
980560213 4:134462479-134462501 AGCATTAGGCAAATGGACTTTGG + Intergenic
981961714 4:150548978-150549000 ATTTTTTGGCAGATTGACTTTGG - Intronic
992306347 5:75443110-75443132 ACCTTTAGCTAGATGGACTAAGG - Intronic
992376936 5:76197541-76197563 AGATTTTGCCACCTGGACTAAGG - Intronic
993174379 5:84464147-84464169 TGCTTTAGGCAGCAGGACTAGGG + Intergenic
996430440 5:123370423-123370445 ATGTTTTGGAAAATGGACTAAGG - Intronic
997340137 5:133138065-133138087 AGCTTTTGGAGGATGGAGTGGGG + Intergenic
998495538 5:142585420-142585442 ATCCTTTGGCAGAGGGTCTAGGG + Intergenic
1003232909 6:4270952-4270974 AGGTTTTGGCAAATGGTCTCAGG + Intergenic
1003313893 6:4993988-4994010 GGCATTTGGCAGATGCACTAAGG + Intergenic
1003410249 6:5855819-5855841 AGCTTTGTGCAGATGGACATGGG - Intergenic
1006470239 6:34224443-34224465 AGCTTTTGGAAGCTGGAAAAGGG - Intergenic
1016724230 6:147342317-147342339 GGCTTTGGGTAGATGGGCTAGGG - Intronic
1017557745 6:155590385-155590407 TGGTTTTGCCAGATGGAATATGG + Intergenic
1017869719 6:158476733-158476755 AGCTTTGACCAAATGGACTAAGG + Intronic
1019087630 6:169495541-169495563 AGCTTTAGCCAGGTGGATTAAGG + Intronic
1019471211 7:1222251-1222273 AGCTTTTAGCACGTGGACTCTGG - Intergenic
1019656586 7:2199265-2199287 AAATGTTGGCATATGGACTAAGG + Intronic
1024404690 7:48964715-48964737 AGATTATGGCAGATGGAGGATGG - Intergenic
1024791820 7:52973639-52973661 AGTTTTTGGAAGATGAACTTTGG + Intergenic
1031760579 7:125708384-125708406 AGCTTATGCCAATTGGACTAAGG + Intergenic
1032061932 7:128732073-128732095 AGTGTTTGTCAGATGGTCTATGG + Intergenic
1034356934 7:150458328-150458350 ATCATTTGGCAGATGGCCTTTGG - Intronic
1034959805 7:155358237-155358259 AGCTGTGGGCAGAGGGACTTTGG - Exonic
1036666727 8:10749225-10749247 ATCTTTAGGTAGATTGACTAAGG - Intronic
1037728215 8:21501545-21501567 AGCTGCTGGCACATGGATTATGG + Intergenic
1038296691 8:26298304-26298326 TGCTCTTAGGAGATGGACTAGGG - Intronic
1038452187 8:27646827-27646849 AACTGTTGGCAGATTGACGATGG + Intronic
1039001526 8:32985622-32985644 AGCTTTTTCTACATGGACTATGG - Intergenic
1039960740 8:42245455-42245477 AGCTGCTGGCAGATGGCCTGGGG - Intergenic
1040654129 8:49484767-49484789 AGATTTTGGCAGAAGTACTTTGG - Intergenic
1042556428 8:70037198-70037220 AGCTGCTGGCAGAAGGTCTAAGG + Intergenic
1044098777 8:88102810-88102832 AGATTTGGGCAAGTGGACTATGG - Intronic
1046157513 8:110312432-110312454 AGCTATTGGCAGTAGAACTAGGG + Intergenic
1047138543 8:122108516-122108538 AGTTTTTGGAACATGGACTTTGG + Intergenic
1049597295 8:143490523-143490545 AGTATCTGGCAGATGGACAAGGG - Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054929767 9:70623903-70623925 ACTGATTGGCAGATGGACTAAGG + Intronic
1055667079 9:78563582-78563604 GGTTGTTGGCAGATGGATTATGG + Intergenic
1058083544 9:100724336-100724358 GGCTTTTGGCGGATGGAAGAGGG - Intergenic
1059423443 9:114206536-114206558 AGCTGTTTGCAGCTGGACTGTGG - Intronic
1059969695 9:119652801-119652823 AGTTTTTGGCTGATTCACTAGGG - Intergenic
1060053136 9:120391238-120391260 AGCTCATGGCAGAAGAACTAAGG + Intronic
1062430326 9:136523978-136524000 AGCTGTTGGCAGATGTGCCAGGG + Exonic
1185540894 X:902435-902457 AGCTTCTGGTAGGTGGACTATGG + Intergenic
1185540957 X:902722-902744 AGCTTCTGGTGGGTGGACTATGG + Intergenic
1188682085 X:33022204-33022226 AGCTTTTGGCAGAGGGTTTTGGG - Intronic
1189260164 X:39672886-39672908 AGCTGTTGGCAGAAGGAGTCAGG - Intergenic
1189822130 X:44880200-44880222 AGCTTTTAGCAGATGTTCAAAGG + Intronic
1196248153 X:113425523-113425545 ACCTTGTGGCAGATGGAATGTGG - Intergenic