ID: 1154026196

View in Genome Browser
Species Human (GRCh38)
Location 18:10709506-10709528
Sequence ATTTCCAGGCTGAACGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154026191_1154026196 18 Left 1154026191 18:10709465-10709487 CCAGGGAACAGAAACAGATCTTT 0: 1
1: 0
2: 0
3: 21
4: 284
Right 1154026196 18:10709506-10709528 ATTTCCAGGCTGAACGTGGTAGG 0: 1
1: 0
2: 1
3: 11
4: 106
1154026190_1154026196 19 Left 1154026190 18:10709464-10709486 CCCAGGGAACAGAAACAGATCTT 0: 1
1: 0
2: 3
3: 40
4: 608
Right 1154026196 18:10709506-10709528 ATTTCCAGGCTGAACGTGGTAGG 0: 1
1: 0
2: 1
3: 11
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154026196 Original CRISPR ATTTCCAGGCTGAACGTGGT AGG Intronic
900270257 1:1783424-1783446 ATTGGCAGGCTGAACGGGGTGGG - Intergenic
900824214 1:4913384-4913406 ATCTCCAGGCTGGCCTTGGTTGG - Intergenic
904834486 1:33326107-33326129 ATTTTCAGGCAGAATGTGGAAGG + Intronic
905445467 1:38025942-38025964 AGTTCCAGGCTGAAGGTAATCGG + Intergenic
905469748 1:38182921-38182943 ATTTCCAGGCTGCATGGGCTGGG - Intergenic
908356434 1:63328289-63328311 AGTGCCAGGCTGAACCTTGTGGG + Intergenic
910359830 1:86404531-86404553 ATTTCTAGGCTGAGGGTGGAGGG + Intergenic
910721142 1:90287412-90287434 TCTTCCAGGCTGAAAGTGGAAGG - Intergenic
913213866 1:116603755-116603777 ATGCCCAGGCTGAACGAGTTGGG + Exonic
915836757 1:159183002-159183024 TTTTCCAGGCTGAATGAGGAGGG - Intronic
919560380 1:199111439-199111461 ATTTCCAGTCTGATCTTTGTAGG - Intergenic
1063447248 10:6127129-6127151 TTTTCCAGGCTGAAGGAGTTGGG - Intergenic
1064955386 10:20902555-20902577 ATTTCCAGGTTGGGTGTGGTGGG + Intronic
1065493594 10:26306998-26307020 ATTTCCAGGCTGGACTTGTTAGG - Intergenic
1066425460 10:35303970-35303992 AATTCCAGGCTGACTGTGATGGG - Intronic
1067157321 10:43792972-43792994 GTTTCCAGGCTGGACGTGGTGGG + Intergenic
1070266924 10:74912228-74912250 ATTTGCAGACTGAACTTGATAGG - Intronic
1070609372 10:77922977-77922999 AGTTCCAGGCCCCACGTGGTAGG + Intronic
1070810614 10:79296018-79296040 ATTCCAAGGCTGAACTTGGGTGG - Intronic
1071973229 10:90929534-90929556 ATTTCCAGATCGATCGTGGTGGG - Intergenic
1072113591 10:92347195-92347217 ATTTCCTGGCCGGGCGTGGTGGG + Intronic
1077700028 11:4432525-4432547 ATGTCCAGGCTGTGGGTGGTGGG + Intergenic
1083760046 11:64810631-64810653 ATTTCCAGGCTCAGCGGGGCAGG - Intronic
1085423387 11:76382319-76382341 ATCTCCAGGGTGAAGCTGGTGGG + Intronic
1088127116 11:106441174-106441196 AGCTCCAGGTTGAACGTGATTGG + Intergenic
1090358977 11:126159858-126159880 ACTTACAGGCTGGATGTGGTGGG - Intergenic
1099550010 12:84032616-84032638 ATTTCTAGGCAGAAAGGGGTGGG + Intergenic
1103015914 12:117494410-117494432 ATTTGCAGGTTAAAGGTGGTTGG - Intronic
1103099786 12:118163570-118163592 ATTTCCTGGCTGGGCATGGTGGG - Intronic
1104876305 12:132037392-132037414 ATTTCCAGGTTGAGACTGGTGGG + Intronic
1105252728 13:18715139-18715161 TCTTCCAGGCTGAAAGTGGGAGG + Intergenic
1105945896 13:25189141-25189163 ATTACCTGGCTGAACGTGAAGGG + Intergenic
1109449962 13:62499309-62499331 TTCTCCTGGCTGAAGGTGGTTGG + Intergenic
1109915838 13:68983992-68984014 ATTTCTAGGCTGATAGGGGTGGG - Intergenic
1110708606 13:78625098-78625120 ATTTCAAGGCTGATCTTGGTTGG - Intronic
1111068582 13:83132187-83132209 ATATACAGGCTGGAAGTGGTGGG - Intergenic
1113094739 13:106651817-106651839 ATTTCGAAGCTTAACTTGGTTGG - Intergenic
1115508385 14:34114926-34114948 ATTTTCAGCCTGAAAGTGGCAGG - Intronic
1115659639 14:35479976-35479998 ACTTCCAGGCTGGGCATGGTTGG + Intergenic
1117160510 14:52984908-52984930 ATTTCCAGGTTGAAGGAGGAAGG + Intergenic
1118456980 14:65953454-65953476 CTTCCCAGGCTGCACCTGGTTGG + Intergenic
1124094776 15:26638891-26638913 AGTTCCCGGCGGAGCGTGGTGGG - Intronic
1128095302 15:64949671-64949693 ATCTCCAGGCTGAGCTTGGCTGG + Intronic
1133522620 16:6573869-6573891 TTTTCCAGCCTGGACGTGATAGG + Intronic
1134021817 16:10926283-10926305 ATTTACAAGCTGAACCTGGATGG - Exonic
1137856826 16:51802854-51802876 TTTTCCAGGCTGGACATGGTGGG - Intergenic
1139903631 16:70347414-70347436 AGATCCATGCTTAACGTGGTTGG + Intronic
1141033302 16:80608132-80608154 ACCTCCTGGCTGAACGTGGTGGG + Exonic
1142707433 17:1704986-1705008 ATATCCAGGCTGGGCATGGTGGG - Exonic
1144100400 17:11937638-11937660 ATCTCCAGGCTGCAGGTGGTTGG - Intronic
1148901836 17:50884447-50884469 ATTACCAGACAGATCGTGGTAGG + Intergenic
1149272792 17:54999673-54999695 ATTTTCTGGCTGAATGTTGTCGG - Exonic
1154026196 18:10709506-10709528 ATTTCCAGGCTGAACGTGGTAGG + Intronic
1155053002 18:22164778-22164800 AACCCCAGGCTGAAGGTGGTGGG - Intergenic
1158528031 18:58232901-58232923 GACTGCAGGCTGAACGTGGTTGG + Intronic
1160224697 18:77003298-77003320 ATTTCCAGGTTGCACATGGCGGG + Intronic
1167432441 19:49462220-49462242 ACTCCCAGGCTGAACCTGGGAGG - Intronic
1202649167 1_KI270706v1_random:165315-165337 TTTTCCAGGCTACACCTGGTAGG - Intergenic
931101422 2:59005863-59005885 TTTTCCTGGCTGGGCGTGGTGGG + Intergenic
939497991 2:142947124-142947146 ATTTCCAGGTTGATTGTGTTGGG - Intronic
940770473 2:157834377-157834399 ATTACCAGGCTGGGCATGGTGGG - Intronic
942496238 2:176542662-176542684 ATCTCCAGGCTGAGAGGGGTTGG - Intergenic
942820467 2:180107874-180107896 ATTCCCAGGATGAAAGTGATAGG + Intergenic
945044338 2:205768703-205768725 ATTTCCAGGGTGCTCCTGGTGGG + Intronic
945706952 2:213247541-213247563 ATTTTCAGGCAGAAAGTGTTGGG + Intergenic
947569448 2:231220685-231220707 ATTTCCAAGCTGGGCGTGGTGGG - Intronic
1171521278 20:25775805-25775827 ACTTCCAGGCTGGACGAGTTGGG - Intronic
1174243404 20:49157161-49157183 ATTTTGAGGCTGGACGTGGTGGG - Intronic
1176838242 21:13815026-13815048 TCTTCCAGGCTGAAAGTGGGAGG + Intergenic
1180017913 21:45099372-45099394 ATTTACAGGCTGGGCGCGGTGGG + Intronic
1181263554 22:21616362-21616384 TGTTCCAGGCTGGGCGTGGTGGG + Intronic
1182573189 22:31254422-31254444 ATTTCCAAACTGAAAATGGTAGG - Intronic
1182747723 22:32618354-32618376 GTTTCCAAGCTGAAAGTGGATGG + Intronic
1184985620 22:48131341-48131363 ATTTAGAGGCTGGGCGTGGTGGG - Intergenic
952399907 3:32953759-32953781 ATTTCCTGGATGTACTTGGTGGG + Exonic
953886364 3:46716548-46716570 ATTTTCAGGCTGGAGGTAGTGGG - Intronic
954500054 3:51004443-51004465 ATTTCCAGGCTCTAAGTTGTAGG + Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961554033 3:127685437-127685459 AGTTCCAGGCAGAATTTGGTTGG + Intergenic
961581755 3:127888884-127888906 ATTTCCAGTCTGAGCCTGGGAGG - Intergenic
963582687 3:147146979-147147001 ACTTCCAGGCTGCACCTAGTTGG - Intergenic
963730313 3:148965062-148965084 ATTTCCAGGATAAAGGTGGGTGG - Intergenic
964304029 3:155321598-155321620 CTTTCCAGGCAGAACATTGTTGG - Intergenic
965454747 3:168884533-168884555 ATTTCCAGGCAACACGTGGTTGG + Intergenic
983081348 4:163388687-163388709 AAGTACAGACTGAACGTGGTTGG + Intergenic
983968718 4:173845116-173845138 ATTTCCAGGCAGAATGTTGAGGG + Intergenic
984238543 4:177191453-177191475 ATTTCCTGGCTGGGAGTGGTGGG + Intergenic
984682569 4:182626641-182626663 ATAACCAGGCTGAATATGGTAGG + Intronic
985141683 4:186846275-186846297 ATGTTCAGGCTGGGCGTGGTGGG - Intergenic
989401902 5:41016764-41016786 CATTCCAGGCTGGACGTGGTGGG - Intronic
999438225 5:151581025-151581047 AGTTACAGGCAGAACCTGGTTGG - Intergenic
999644554 5:153704924-153704946 ATCTGCAGGCTGAAAGTTGTAGG - Intronic
1003996341 6:11544592-11544614 AATAGCAGGCTGAACTTGGTAGG - Intronic
1007366532 6:41398043-41398065 CTTTTCAGGCTGACCATGGTGGG - Intergenic
1011261841 6:85477858-85477880 ATTTCCTGACTGAGTGTGGTTGG + Intronic
1012975420 6:105776514-105776536 ATTTCCAGAGTCAACGTGGGAGG - Intergenic
1015469337 6:133586018-133586040 ATTTTCAGGATGAAAGTGCTAGG - Intergenic
1025612897 7:63093896-63093918 ATTTGGTGGCTGAGCGTGGTTGG + Intergenic
1029946568 7:104539515-104539537 ATTTCCAGGCAGAAATGGGTGGG + Intronic
1032790428 7:135238436-135238458 AATTTCAGGCTGAGCGTGTTTGG + Intronic
1036516688 8:9450850-9450872 ATTTCCTGGCTTCACTTGGTAGG + Intergenic
1038115785 8:24553733-24553755 ATGTGCAGGCTGAAGGTGGAAGG - Intergenic
1038317850 8:26502749-26502771 CTTTCCAGGCTGGGTGTGGTTGG - Intronic
1041262208 8:56031341-56031363 ATTTCCAGGAAGAACGTAATTGG - Intergenic
1048069559 8:131007303-131007325 ATTTCCAAGGTGAAAGAGGTAGG + Intronic
1048182349 8:132207560-132207582 ACTTCCAGGCTGAAGGCAGTGGG + Intronic
1050747205 9:8890307-8890329 TTTTCCAGGCTTAATGTGCTAGG + Intronic
1053314754 9:37041871-37041893 CATTCCAGGCTGAGGGTGGTTGG - Intergenic
1054778401 9:69143515-69143537 TTTTATAGGCTGAACTTGGTTGG - Intronic
1055395096 9:75865722-75865744 TTTTCCAGGCTGAGGGTGGTTGG - Intergenic
1057518107 9:95738472-95738494 ATTTCCAGGCTGAAAGGGCAGGG + Intergenic
1058066111 9:100549722-100549744 ATTTCCAGGGTAACAGTGGTAGG + Intronic
1060090511 9:120738701-120738723 AGTTTCAGGCTGGGCGTGGTGGG - Intergenic
1062328187 9:136022759-136022781 ACTTCCACGCTGTACTTGGTGGG + Intronic
1186223200 X:7371434-7371456 AATTCTAGGCAGAAGGTGGTAGG + Intergenic
1189396048 X:40623780-40623802 GTTTCGAGGCTGTACGCGGTAGG - Intergenic
1189463129 X:41258550-41258572 ACTTCCAGTCTGATGGTGGTGGG - Intergenic
1195728133 X:107937976-107937998 CTTTACAGGATGAACTTGGTGGG - Intergenic
1201592759 Y:15633703-15633725 AATTCCAGGCAGAAGGTGGAAGG + Intergenic