ID: 1154033956

View in Genome Browser
Species Human (GRCh38)
Location 18:10780221-10780243
Sequence AAAATCGTGTTGTCAGATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154033956 Original CRISPR AAAATCGTGTTGTCAGATAG TGG (reversed) Intronic
904165968 1:28555376-28555398 AAATGCGTATTTTCAGATAGAGG + Intronic
905992503 1:42351032-42351054 CAAATCATGTTGGCATATAGTGG + Intergenic
911857081 1:102892332-102892354 GAAATAGTGTTTCCAGATAGAGG - Intronic
915368106 1:155326593-155326615 AAAATCCTGTTGGCAGGTACAGG - Exonic
1072331557 10:94358693-94358715 AAAAGCTTGTGGTCAGAGAGAGG - Intronic
1074144560 10:110705235-110705257 AAAATAATGTTGTCATATAGAGG - Intronic
1074227503 10:111500173-111500195 TAAATAGTGTTATCAGATATAGG - Intergenic
1081071358 11:38613927-38613949 AAAATTGTGTTTTGAGAGAGAGG - Intergenic
1082586389 11:54946950-54946972 AAAACCGTGTTTCCAGAGAGAGG + Intergenic
1085170123 11:74442603-74442625 AACATCGTGTAGTAAGTTAGAGG + Intergenic
1087076122 11:94128743-94128765 AAAATCCCTTTGTCAGAGAGTGG + Intergenic
1095494835 12:42773374-42773396 AGAATCGTTTTGTGAGATGGTGG + Intergenic
1098006333 12:66000486-66000508 TAAAACCTGTTTTCAGATAGAGG + Intergenic
1104629701 12:130390253-130390275 AAAATAGTGCTGTGAGACAGTGG + Intergenic
1105470569 13:20690689-20690711 ATTTTCGTGTTTTCAGATAGTGG + Exonic
1106174389 13:27317128-27317150 AAAATTCTGTTGTCAGAAATGGG + Intergenic
1107072737 13:36289088-36289110 AAAACCTTGTTTTAAGATAGGGG - Intronic
1107518085 13:41151250-41151272 AAAATCTTGTCTTCAGATAATGG + Intergenic
1109065606 13:57685712-57685734 AAAATTGTGGAGTCAGATTGTGG + Intronic
1109801742 13:67388350-67388372 CAAATTGTTTTGTCATATAGTGG + Intergenic
1110343580 13:74419857-74419879 AAAATCTTGTTGTTGGAAAGAGG + Intergenic
1112320434 13:98402153-98402175 AAAATCGTGCTGTGAGATACTGG + Intronic
1112423196 13:99272490-99272512 AAACTCGTGCTGTCATAGAGTGG + Intronic
1120928451 14:89821785-89821807 AAAATAGTTTTGTCACATAGAGG - Intronic
1123910411 15:24960309-24960331 AATATTGTGGTGTCAGATGGTGG + Intronic
1124353090 15:28973485-28973507 AAAACACTGTTGTCACATAGAGG + Intronic
1126116390 15:45211485-45211507 AAAATCTTGTTGTCAATTGGAGG + Intergenic
1131452102 15:92550238-92550260 AAAATCATGTTCTGAGATACTGG - Intergenic
1139650732 16:68360957-68360979 AAAATCGTGTTGTGAAAGAATGG + Exonic
1139737435 16:69003593-69003615 AAAAACGTGTTTTAACATAGGGG + Intronic
1142454693 16:90212427-90212449 GAAATCGTGTGGTCAGTTTGCGG + Intergenic
1146141691 17:30373785-30373807 AAAACCCTGTTGTCAGATCCTGG + Intergenic
1154033956 18:10780221-10780243 AAAATCGTGTTGTCAGATAGTGG - Intronic
1157936564 18:51879781-51879803 CAGATGGTGTTGTCAAATAGAGG + Intergenic
1158092060 18:53726567-53726589 AAAATCATGGTGGCAGATAAAGG + Intergenic
1158442333 18:57487822-57487844 AAAATAGTTTTGACATATAGAGG - Exonic
925268315 2:2582992-2583014 AAAATCATTTTGCCAGAAAGAGG + Intergenic
926524797 2:13966060-13966082 AAAATAGTGTCGTCAGTAAGTGG + Intergenic
929818169 2:45252427-45252449 AAAATCATGTTATAAAATAGGGG + Intergenic
929987712 2:46752787-46752809 AAAACAGTTTTGTCAGGTAGGGG - Intronic
933509932 2:83227601-83227623 AAAATTGTGTTCTCAGGTAGAGG + Intergenic
936389681 2:112059861-112059883 AAAATACTCTTGTCAGAGAGAGG + Intronic
939231780 2:139436084-139436106 AAAACCCTGTTGTAATATAGGGG + Intergenic
941417412 2:165238544-165238566 AAAATGGTGTTGTAAAAAAGTGG + Intergenic
945768304 2:214007982-214008004 ATAATTGTGTTATCAGAGAGGGG - Intronic
946786277 2:223247166-223247188 AAAATCTTTTTGTCAAATAATGG + Intergenic
1170974737 20:21151433-21151455 AAAATCGTATTCACAGATAGAGG + Intronic
1172394439 20:34590258-34590280 AAAATCATGTTGTCAGGGACTGG + Intronic
1174710855 20:52703563-52703585 AAAATAGTGTTGTCTCCTAGAGG + Intergenic
1182345092 22:29657254-29657276 AGCATCATGTTGTCAGATTGGGG + Intronic
1183471717 22:38011431-38011453 AAAAATATGTTGTCAGATAAAGG + Intronic
951136876 3:19114201-19114223 AAAATCATGTAGTGAGAGAGAGG - Intergenic
956966340 3:74465678-74465700 AATATGCTGTTGTCAGATAGAGG - Intronic
957471431 3:80662587-80662609 AAAATCTTGCTGTCATCTAGAGG + Intergenic
957607568 3:82422410-82422432 AAAATAGTTTTGGAAGATAGAGG - Intergenic
965742681 3:171892281-171892303 AAAATCGTTTTGTGGTATAGAGG - Intronic
966686110 3:182697716-182697738 CAAATCCTGTTATCAGATAATGG + Intergenic
966994014 3:185262649-185262671 AAAATCTTGTTTTAATATAGGGG - Intronic
967739344 3:192987757-192987779 AAAATCGTTTTGGCAGAGATTGG + Intergenic
969450372 4:7269419-7269441 AAGATCGTGTTCACAGATACTGG - Intronic
971842821 4:31876278-31876300 AAAATAGTGTTGTGATACAGAGG + Intergenic
974277643 4:59745596-59745618 AAAATCCTATTTTCAGATACTGG - Intergenic
974310305 4:60198941-60198963 AAAAAAGTGTTGGGAGATAGAGG + Intergenic
976338095 4:83913852-83913874 AAAATAATTTTGTCACATAGAGG - Intergenic
976509041 4:85886202-85886224 TAAATTATGTTGTCAGATAATGG - Intronic
977053608 4:92162244-92162266 TAAATGGTCTTTTCAGATAGTGG - Intergenic
977622306 4:99151223-99151245 AAAATCTTGTTTTAACATAGGGG - Intronic
978373148 4:108049375-108049397 AAAATAATGTTGCCAGATATTGG + Intronic
978589260 4:110306649-110306671 AAAATACTTTTGTCAGCTAGAGG + Intergenic
980340166 4:131534198-131534220 AAAATCTTGTTTTAACATAGGGG + Intergenic
984216596 4:176920816-176920838 AAAATTGGGTTGAGAGATAGTGG - Intergenic
993399663 5:87432807-87432829 AAAATGGTGGTGTCAGATGTTGG - Intergenic
995079650 5:108034412-108034434 AAAATTGTGTTGCCAGAAACTGG + Intronic
997246485 5:132354282-132354304 TAAATAGTGTGGTCAGATAAGGG - Intergenic
1000254495 5:159525111-159525133 ACAATCCTTTTTTCAGATAGGGG + Intergenic
1001233262 5:170008260-170008282 CAAATCCTGTTGTCTGAGAGTGG + Intronic
1010300941 6:74258364-74258386 AAAAACAAGTTGTCAGAAAGAGG - Intergenic
1011008825 6:82680731-82680753 AAATTAATGTTGTCATATAGAGG + Intergenic
1023054122 7:36278257-36278279 AAAATGGTGTTGCCAGGGAGGGG + Intronic
1030954854 7:115839499-115839521 AAAATTGTGGTCTGAGATAGAGG - Intergenic
1039177505 8:34826024-34826046 AATATCTTCTTGTCAGACAGCGG + Intergenic
1041403476 8:57469762-57469784 AAAAAAGTGTTGTCAGACTGGGG - Intergenic
1041505963 8:58598085-58598107 AAAATCTACTTGTCAGGTAGAGG + Intronic
1042127172 8:65550021-65550043 AAATCCGTGTTGTCAGACACAGG - Intergenic
1042160612 8:65890512-65890534 AAAATGGTGCAGCCAGATAGAGG + Intergenic
1043132536 8:76479604-76479626 AAAATGGTTTTGCCAGATATAGG + Intergenic
1044215546 8:89605319-89605341 AAAATCAACTTGTAAGATAGTGG + Intergenic
1044583732 8:93849480-93849502 AAAATCCTATTTACAGATAGCGG + Intergenic
1048621860 8:136142363-136142385 AAGGTCTTGTTGTTAGATAGAGG + Intergenic
1051146848 9:14035805-14035827 AAACTCCTGTTGACACATAGGGG + Intergenic
1052321614 9:27173470-27173492 AAAATCCTGTTGTCCAGTAGTGG - Intronic
1052823533 9:33158762-33158784 AATATGGTGTGGTCAGAGAGAGG - Intronic
1058268266 9:102934635-102934657 AAAATAATGTTGTCAAATAGTGG - Intergenic
1189568098 X:42264798-42264820 AAAATGGAGTTGTCGGGTAGAGG + Intergenic
1189662584 X:43317828-43317850 AAAATCATGTTGTCATATGTTGG - Intergenic
1190922293 X:54865526-54865548 ATAATGGTGTTGAGAGATAGTGG - Intergenic
1194000889 X:88427466-88427488 AAAATCCAGCTGTCAGATAAGGG + Intergenic
1197325842 X:125092045-125092067 AACATCGCATTGGCAGATAGTGG - Intergenic