ID: 1154037239

View in Genome Browser
Species Human (GRCh38)
Location 18:10814911-10814933
Sequence GAGGAAAGAGTTCAACCTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154037235_1154037239 25 Left 1154037235 18:10814863-10814885 CCTTGAAAGGGGGAGGAAGCTGC No data
Right 1154037239 18:10814911-10814933 GAGGAAAGAGTTCAACCTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154037239 Original CRISPR GAGGAAAGAGTTCAACCTTA CGG Intronic