ID: 1154037239 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:10814911-10814933 |
| Sequence | GAGGAAAGAGTTCAACCTTA CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1154037235_1154037239 | 25 | Left | 1154037235 | 18:10814863-10814885 | CCTTGAAAGGGGGAGGAAGCTGC | No data | ||
| Right | 1154037239 | 18:10814911-10814933 | GAGGAAAGAGTTCAACCTTACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1154037239 | Original CRISPR | GAGGAAAGAGTTCAACCTTA CGG | Intronic | ||