ID: 1154038162

View in Genome Browser
Species Human (GRCh38)
Location 18:10826962-10826984
Sequence GTGAAAAATCCAACCTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154038162 Original CRISPR GTGAAAAATCCAACCTTTGA AGG (reversed) Intronic
900391010 1:2433907-2433929 GGGAAAATTCAAACGTTTGAAGG - Intronic
902428125 1:16341197-16341219 TTGCAAAATCCAACATTTAAAGG + Intronic
905234634 1:36537662-36537684 GTGAAAAGTGAAACCTCTGAAGG - Intergenic
906817104 1:48890352-48890374 GTAAAAATTCCTACCTTTGCAGG + Intronic
910199293 1:84681971-84681993 ATGAACAATCCAACCTTGGTAGG + Intronic
910310527 1:85819043-85819065 GATAAAAATCCAACTTTTGCAGG + Intronic
912997426 1:114544939-114544961 GTGAAAAAAACAACCTGTAAAGG - Intergenic
915140287 1:153763691-153763713 GTGTAAAATCCCAGCTTGGATGG - Intronic
918106827 1:181422603-181422625 GTAAGATATCCAACCTTTGTGGG + Intronic
921891637 1:220359803-220359825 CTGAATAATCCAGCATTTGATGG + Intergenic
1065836443 10:29662371-29662393 GTGGCTAATCCAACCCTTGATGG - Intronic
1065850960 10:29788369-29788391 GTGAAAAAGCCAATCTTGAAAGG + Intergenic
1066137203 10:32461200-32461222 ATGAAAAATTCAACTTATGATGG - Intronic
1066323479 10:34328918-34328940 TTGAAAAATACAACATTTGGTGG + Intronic
1066808823 10:39297071-39297093 GTGTAAAATCCTTCCTTTGATGG - Intergenic
1069007546 10:63335460-63335482 GTGAAAATGCCAACTTTTAAGGG - Intronic
1073039671 10:100594617-100594639 GTGAAAAATCCAGTCTCAGAAGG + Intergenic
1073705152 10:105974849-105974871 GGCAATAATCCAACATTTGAAGG + Intergenic
1074929286 10:118107085-118107107 GTGAAAAGTGCTACCTTGGATGG - Intergenic
1077849347 11:6059743-6059765 GTGATAAATACAAGCTTTGCGGG + Intergenic
1081133161 11:39405098-39405120 GAGATAAATCCAACCTAGGATGG - Intergenic
1083752993 11:64772210-64772232 GTTAAAAATTCAACCTTTGGAGG + Intronic
1084682506 11:70674707-70674729 GTGAACATTCCAGGCTTTGAGGG + Intronic
1085335689 11:75692632-75692654 ATGAAAAATCCAACCTCAAAAGG - Intergenic
1086596091 11:88572757-88572779 ATAAAAAATACAACCATTGATGG - Intronic
1087130217 11:94662902-94662924 GTGAAAAATCCAGACTTCCAAGG - Intergenic
1088638478 11:111847886-111847908 GTGGAAAATTATACCTTTGAAGG - Intronic
1089081555 11:115780490-115780512 GACAAAAATACTACCTTTGAGGG - Intergenic
1090649965 11:128798022-128798044 GTGAACATTGCAACCTATGAGGG + Intronic
1090957872 11:131529830-131529852 GTGAATAATCTACCCTTGGAGGG + Intronic
1091358964 11:134959438-134959460 GTGAAAATCCCAACCTGGGAAGG + Intergenic
1095993919 12:48062029-48062051 GCTAAAAATCCAGCCTCTGATGG + Intronic
1096313021 12:50538236-50538258 GTGAAAAATTCCACCTCAGAGGG + Intronic
1097957322 12:65499492-65499514 GTGATAAATACAACCACTGATGG - Intergenic
1099009062 12:77269883-77269905 AAGAAAAATCCATCCTTTGTTGG - Intergenic
1100509686 12:95257178-95257200 AAAAAAAATCCAACTTTTGATGG - Exonic
1104540961 12:129664275-129664297 GTGAAGAATCCCACCTTTAAGGG + Intronic
1105409916 13:20162420-20162442 TTGAAAAATGCTACCTTTGAAGG + Intergenic
1106553854 13:30793684-30793706 GTTAAAAATTCAACCTTTCATGG - Intergenic
1106687376 13:32075104-32075126 GTTAAAAATCAGACCTATGAAGG + Intronic
1107846285 13:44516740-44516762 TTTAAAAATCCTGCCTTTGAGGG - Intronic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108430425 13:50347866-50347888 CTGAGCAAACCAACCTTTGATGG + Intronic
1110192439 13:72746232-72746254 GTGAGAATTCCAGCCTTTGAAGG - Intronic
1113234848 13:108261183-108261205 GAGAAAAATCATATCTTTGATGG - Intronic
1114309428 14:21453217-21453239 GTGAAAATTGAAACCTTTTAGGG - Intronic
1114556482 14:23565263-23565285 GAGAAAACTCCAACATGTGAGGG + Intronic
1115620010 14:35132155-35132177 TTGAATAATCCAACCTTCAACGG - Intronic
1117383513 14:55189010-55189032 GTAAACATTCCAACCTTGGAAGG - Exonic
1117862526 14:60107470-60107492 GTTATAAATCCTACCCTTGAAGG + Intronic
1119245477 14:73102444-73102466 ATGATAAATCCATCCTTGGAAGG - Intronic
1122948687 14:105028111-105028133 GTCAAAATACCAACCTTTTATGG + Intergenic
1124443350 15:29706290-29706312 GTCAAAAATTCAATTTTTGAAGG + Intronic
1127599085 15:60517251-60517273 TTGGAAAATCCAACCTGGGATGG + Intronic
1128487251 15:68105897-68105919 TTGAAAAATCTAACCTATGTGGG - Intronic
1128761188 15:70217053-70217075 GGGAAAAATCCAAGCCTTGCAGG - Intergenic
1130315949 15:82796729-82796751 GTGGAAATGCCACCCTTTGATGG - Intronic
1130617975 15:85430830-85430852 GTGAAAAAGCAAGGCTTTGAGGG + Intronic
1131276213 15:90983616-90983638 ATGAAAACACCAACCTTTGTGGG - Intronic
1131302753 15:91214037-91214059 GTGGAAGATGCTACCTTTGATGG - Intronic
1131334882 15:91539389-91539411 GTGAAAATTCCAAGCTCTCAGGG + Intergenic
1133443790 16:5842656-5842678 ATGAGAAATCCATTCTTTGAAGG - Intergenic
1137244976 16:46694878-46694900 GTGAGAAATCCATTCTTTAAGGG - Intronic
1139664060 16:68443922-68443944 GTGAGGAAACCAAGCTTTGAGGG - Intronic
1140198205 16:72873138-72873160 GTGAAAAATACGCCCATTGAAGG - Intronic
1140431899 16:74911158-74911180 GTGAAAAATCAGACCTTTTCCGG - Intronic
1143839391 17:9719768-9719790 TTGAAAAATCCAGCGTTTGCTGG + Intronic
1148602266 17:48903380-48903402 GTGAAAATTCCTACCTCTCAAGG - Intergenic
1149360527 17:55890280-55890302 GTGAAAAATCCAAGCAAAGATGG - Intergenic
1150500556 17:65647066-65647088 TTCAAAAATCCAACCAGTGAAGG + Intronic
1154038162 18:10826962-10826984 GTGAAAAATCCAACCTTTGAAGG - Intronic
1154496010 18:14961801-14961823 GTGAAAATTCCAACCTGGGAAGG - Intergenic
1157756074 18:50218873-50218895 GTTAAAGATCACACCTTTGACGG + Intergenic
1158766605 18:60457776-60457798 GTCAAAACTCCATCCATTGATGG - Intergenic
1164958078 19:32404462-32404484 CTGACAAATACAACGTTTGATGG + Intergenic
927508972 2:23632508-23632530 GTGAAATATCCACTCTTTGCAGG + Intronic
932626492 2:73300573-73300595 GTCAAACAACCAACCTGTGAGGG + Intergenic
933792991 2:85897963-85897985 CTGAAATTTCCACCCTTTGAGGG - Intergenic
935446339 2:103160554-103160576 GTGAAAAATTCAACATTACAGGG + Intergenic
936664260 2:114576271-114576293 GTGAGAAATCCAATTTTTCAAGG + Intronic
937955400 2:127419186-127419208 ATTAAAAATCCAACCCTTGCTGG - Intronic
939455099 2:142423688-142423710 GTAAAAAATACAACCCTGGATGG - Intergenic
942135291 2:172919329-172919351 GGGCAAAATCCAGACTTTGAGGG - Intronic
942623940 2:177878547-177878569 GTGAAAAATCCCTCATTTGCAGG - Intronic
942847065 2:180439800-180439822 GTCAAAGATTCCACCTTTGAGGG + Intergenic
1170578930 20:17683475-17683497 GTGAAAAATACAAGCCTTCATGG + Intergenic
1171314334 20:24175389-24175411 GTGAAAAATCTTCCATTTGAAGG + Intergenic
1173551216 20:43934322-43934344 GTGAAATACCCATCCTGTGATGG - Intronic
1175398551 20:58685336-58685358 GTAAAAAATGCTACCTATGAAGG + Intronic
1178116194 21:29419767-29419789 GTAAAAAATCCAATCTCTAAAGG - Intronic
1178145258 21:29732222-29732244 GTGAAGAATCCAGGCTTTGGGGG + Intronic
1183793763 22:40098073-40098095 ATGTAAAATCCACCCTTAGAGGG + Intronic
1184204512 22:42993332-42993354 GTGAGAAGTCCACCCTCTGAGGG - Intronic
949229520 3:1734258-1734280 GTGAAAAATCCCACTTCTGGGGG - Intergenic
949281209 3:2349655-2349677 ATGAAAAATCCAAGCTTGTAGGG + Intronic
951245056 3:20331298-20331320 CAGAAAAATCCAACGTTTGGTGG - Intergenic
951747183 3:25992210-25992232 GTGAAAAACACACCCTTGGATGG + Intergenic
952753877 3:36849185-36849207 GTGAAAACTACAACCTTTATGGG - Intronic
954090541 3:48280270-48280292 TTGAAATATCCAAGCTTTTATGG + Intronic
954264555 3:49462165-49462187 TTGAGAAATCCACTCTTTGAAGG - Intergenic
955667723 3:61368175-61368197 GAGAAAAATCCAACTTTTAAAGG - Intergenic
957334064 3:78804051-78804073 CTGAAAAATACAAACTTTGCAGG - Intronic
958480742 3:94643179-94643201 GTGAAAATTCTTAGCTTTGATGG + Intergenic
958907447 3:99957564-99957586 GTGAAAATTCCAACTGTTTACGG - Intronic
963750107 3:149168988-149169010 GAGAAAAATGCAACATTTGGAGG - Intronic
964104088 3:153020975-153020997 GACAAAAATCCAGCCTTTGGTGG + Intergenic
964524016 3:157597596-157597618 TTCAAAAGTCTAACCTTTGAAGG - Intronic
965065093 3:163838569-163838591 ATGAAAACTCCAAACTTTCATGG + Intergenic
965848561 3:172993163-172993185 GTTTAAAATCCAACCTTTGTTGG + Intronic
966952603 3:184836003-184836025 TTGAAAAATCCAAACTTGGCTGG - Intronic
970189239 4:13495297-13495319 ATGAAGAAACCAACCTTTAAAGG + Intergenic
970890525 4:21038926-21038948 GTGAAAAAAGCATCCTGTGAAGG + Intronic
970893107 4:21070097-21070119 GTGAAAACTCCAATCTTGAAAGG - Intronic
970914461 4:21316458-21316480 GTGAAAAATTAAATCTTTAATGG - Intronic
974227207 4:59061406-59061428 GTGAAAAATTAAAACTTTTATGG + Intergenic
975365859 4:73526914-73526936 GTGGCAAATGCAATCTTTGAAGG + Intergenic
976730681 4:88258027-88258049 GTGAACAAGCCAACTTGTGATGG - Exonic
977524977 4:98132991-98133013 GGGAAAAAGCAAACCTTTCAAGG + Intronic
979504479 4:121479977-121479999 GGGAAAAATCCAGTCTTGGAAGG - Intergenic
980539025 4:134169102-134169124 GGGAAGAATCCCACCTTTTATGG - Intergenic
980814389 4:137924145-137924167 GAGAAAAGCCCAGCCTTTGAAGG - Intergenic
982252939 4:153425470-153425492 GTTAAAAATACTACCTTTTAGGG + Intergenic
985630274 5:1010260-1010282 GTGAGAAAGCTAACATTTGATGG + Intronic
986509124 5:8484758-8484780 GAGGAAAATCAAACCTTTTATGG + Intergenic
988356614 5:30184608-30184630 GTGAAATATCTAACTTTTAAGGG + Intergenic
989100749 5:37820801-37820823 TTGAAAATTCCTTCCTTTGATGG + Intronic
989841951 5:46086800-46086822 GTGATAAATCTTTCCTTTGATGG + Intergenic
989854932 5:46272407-46272429 GAGTGAAATCCTACCTTTGATGG - Intergenic
990495517 5:56343865-56343887 TTGTAAAATCCTACCTTGGAAGG + Intergenic
992223938 5:74600191-74600213 ATGAAAAATCCTACCTTTAAGGG - Intergenic
995346660 5:111128160-111128182 ATGAAAGACCCAACTTTTGAGGG - Exonic
1001120924 5:168979215-168979237 GTTTAAAATCAAAGCTTTGAAGG - Intronic
1001498761 5:172211670-172211692 GTGAAAAATTCCATCTGTGATGG - Exonic
1001728250 5:173926737-173926759 GAGCAAAATTCAATCTTTGAAGG - Intronic
1002518498 5:179776568-179776590 GTGAAAATTTCACCCTCTGAGGG + Exonic
1002961801 6:1922575-1922597 TTGAAAAAGGCAACATTTGATGG - Intronic
1004181370 6:13383234-13383256 GTGGAAAATACAAGATTTGATGG - Intronic
1007795549 6:44343890-44343912 GTGAAATATCCAGACTTTGCGGG + Intronic
1008067782 6:47068757-47068779 GTGAAAAAGCCAACCCTAAAAGG + Intergenic
1009405723 6:63310056-63310078 GTGAAAATTCCCAGCTGTGAAGG - Intronic
1009904990 6:69859324-69859346 GTCAAAACTCCATCCCTTGATGG - Intergenic
1012556060 6:100513095-100513117 TTGAAAAATGCTACCTTTGGAGG - Intronic
1013002783 6:106041273-106041295 GTGAAAAATACAATGTTTGCAGG - Intergenic
1014846670 6:126286163-126286185 TTGAGAAAACAAACCTTTGATGG - Intergenic
1014914789 6:127133387-127133409 GAGAAAAATCCCACCTTAGGAGG + Intronic
1016265332 6:142226396-142226418 GAGAAAAATCTCAGCTTTGAAGG + Intergenic
1021335938 7:19402611-19402633 TTTAAAAATCCAATCCTTGATGG + Intergenic
1023069114 7:36411030-36411052 GTGTAAAATACAGCTTTTGATGG + Intronic
1023336559 7:39176635-39176657 GTGAATAAAACAACATTTGAAGG - Intronic
1023607938 7:41946537-41946559 GAGAAAAATGCAACATTGGAGGG - Intergenic
1027587247 7:80074142-80074164 TTAAAAAATCCATCCATTGATGG - Intergenic
1027827568 7:83135409-83135431 GTGAAACAACCAACCCTTCATGG - Exonic
1028794346 7:94886860-94886882 GTGAAGAATTCAACCTTAGAGGG + Intergenic
1030097844 7:105916965-105916987 CTGAAGAATCCACCCTATGAAGG + Intronic
1030204566 7:106940292-106940314 AAGAAAAATCCAACTGTTGAGGG - Intergenic
1030695951 7:112585792-112585814 ATGAAAAATTCAAGTTTTGATGG - Intergenic
1031261953 7:119532752-119532774 GTGAAATTTCCAAACTTTTATGG - Intergenic
1033808970 7:144987655-144987677 ATGAAAAATCCAAATTTTGGGGG + Intergenic
1036680050 8:10865309-10865331 CTTAAAAATCCTCCCTTTGAGGG - Intergenic
1037925222 8:22839138-22839160 GTGAAAAACGCCACCTTTGCAGG - Intronic
1038156310 8:24994009-24994031 AGGAAAAATACTACCTTTGATGG - Intergenic
1041990267 8:63979965-63979987 GTGGAAAATAGAACCTTAGAAGG - Intergenic
1042497708 8:69473184-69473206 AAGAAAAATTTAACCTTTGAAGG - Intronic
1047131360 8:122023790-122023812 GTGAAAAATGCAAGCCATGAAGG - Intergenic
1047199379 8:122752006-122752028 TGGAAAATTCCAACCTTTCAAGG + Intergenic
1048698685 8:137058961-137058983 GTCAAAAATGGAAGCTTTGATGG - Intergenic
1055108281 9:72535305-72535327 GGGAGAAATCCAAACTTTCAAGG - Intronic
1056361197 9:85859440-85859462 GTGAAATATTTAACCTATGAGGG + Intergenic
1056732643 9:89178943-89178965 GTGAAAAATCAAAGGTTGGAAGG - Intergenic
1058239327 9:102536899-102536921 GTTAAAAATCCAACTATTTAAGG - Intergenic
1060467755 9:123922429-123922451 TTAAAAAATACAAACTTTGAAGG + Intronic
1060722416 9:125987794-125987816 GTGAAAACTCCCACCGTCGAAGG - Intergenic
1187200700 X:17131189-17131211 TTGAGAAATCCTACATTTGAGGG + Intronic
1190887417 X:54541888-54541910 GTGAAAAAAACAATCTATGAGGG - Intronic
1192175677 X:68883638-68883660 GGGAAAAATCAAAACTTTGTTGG - Intergenic
1193420338 X:81275276-81275298 GTGAAAACCCCATACTTTGAGGG - Intronic
1200949183 Y:8877372-8877394 GTGAAAAATAAAATATTTGATGG + Intergenic