ID: 1154040242

View in Genome Browser
Species Human (GRCh38)
Location 18:10847577-10847599
Sequence ACGTGGGTGTAGTGGGGACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154040242_1154040250 -1 Left 1154040242 18:10847577-10847599 CCCGGTCCCCACTACACCCACGT 0: 1
1: 0
2: 1
3: 13
4: 178
Right 1154040250 18:10847599-10847621 TAGGCCCCCAAACGATACCAAGG 0: 1
1: 0
2: 0
3: 1
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154040242 Original CRISPR ACGTGGGTGTAGTGGGGACC GGG (reversed) Intronic
900112787 1:1015590-1015612 ACAGGGGTGAGGTGGGGACCCGG - Intergenic
900121136 1:1049141-1049163 AGGTGGGTGGGGTGGGGACGGGG + Intronic
900438276 1:2641526-2641548 ACATGCGTGCAGTGGGGGCCCGG + Exonic
900481675 1:2902502-2902524 TCGTGGGTGCAGTGGGGAGTTGG + Intergenic
900481726 1:2902674-2902696 TCGTGGGTGCAGTGGGGAGTCGG + Intergenic
901234721 1:7661670-7661692 CCGTGGGTGCAGAGGGGACCTGG - Intronic
901798952 1:11696186-11696208 GCATGGGTGTGGTGGGGGCCAGG - Intronic
902822120 1:18949825-18949847 ACGTGGGGGGAAGGGGGACCCGG + Intronic
903176923 1:21586996-21587018 ACGTGGGTGCAGCTGGGAACGGG - Intergenic
904028740 1:27520905-27520927 AGGTGGCTCTAGTGGGGCCCAGG + Intergenic
905642651 1:39601965-39601987 TCCTGGGTGGAGTGGGGACTTGG - Intergenic
905975109 1:42168748-42168770 ATGTGGGGGTGCTGGGGACCAGG - Intergenic
907796005 1:57717953-57717975 GGGAGGGTGTAGTGGAGACCAGG + Intronic
910530337 1:88228741-88228763 GCGGGGGCGTAGAGGGGACCAGG - Intergenic
910631307 1:89357775-89357797 GCGTGGGAGCAGTGGGTACCTGG - Intergenic
912715969 1:111983746-111983768 CTGAGGGTGGAGTGGGGACCAGG - Intronic
913277331 1:117151689-117151711 TCGTGGGTCGAGTGGGGACTTGG - Intronic
914793454 1:150899848-150899870 TCCTGGGTGGAGTGGGGACTTGG + Intergenic
915552970 1:156645968-156645990 ACATGGGTGTGGTAGGGAGCAGG + Intronic
916365734 1:164025391-164025413 TCCTGGGTGGAGTGGGGACTTGG - Intergenic
917079126 1:171238013-171238035 ACGTGGGTGGCATGGGGAACAGG - Intergenic
921938668 1:220817670-220817692 TCCTGGGTCTAGTGGGGACTTGG - Exonic
924179315 1:241424631-241424653 ACCCGGGTGCAGTGAGGACCTGG + Intergenic
1063057725 10:2522290-2522312 ACGTGGGTGTCGCGTGGATCAGG - Intergenic
1063057742 10:2522374-2522396 ACGTGGGTGTCGCGTGGATCAGG - Intergenic
1063958521 10:11286638-11286660 ACGTGGGTGTTGAGAGGCCCTGG - Intronic
1064219437 10:13427996-13428018 TCCTGGGTGGAGTGGGGACTTGG + Intergenic
1067726391 10:48774317-48774339 GCGTGGGTGTAGTGGGGATGGGG + Intronic
1070073162 10:73109208-73109230 TCCTGGGTGGAGTGGGGACTTGG + Intergenic
1070648716 10:78219599-78219621 TCCTGGGTGGAGTGGGGACTTGG + Intergenic
1071061771 10:81578420-81578442 TCCTGGGTGGAGTGGGGACTTGG + Intergenic
1073537661 10:104292301-104292323 AGCTGGGTGTAGTGGTGCCCAGG - Intronic
1073656805 10:105425425-105425447 AAGTGGGTCCAGTGGGTACCTGG - Intergenic
1076702897 10:132283464-132283486 AGGAGGGTGTCATGGGGACCAGG + Intronic
1077888227 11:6401739-6401761 ACGTGGGTGGGGTGGGGACCAGG - Intronic
1078596079 11:12687916-12687938 AGGTGGGTGTAGTGGGTAGGGGG + Intronic
1079136057 11:17776627-17776649 CTGTGGGTCTAGTGGGGGCCTGG + Intronic
1081709663 11:45208740-45208762 AGGAGGGTGTGGTGGGGGCCAGG + Intronic
1084948317 11:72650864-72650886 GTGTGTGTGTAGTGGGGACTGGG - Intronic
1085173502 11:74467611-74467633 AAGTGGGTGTGCTGGGGCCCGGG - Exonic
1085412342 11:76298652-76298674 ATGTGGCTGTTGTGGGGACTGGG + Intergenic
1086091434 11:83008759-83008781 ATGTTGGTGCAGTGGGGACAGGG - Intronic
1089400025 11:118159053-118159075 ACAGGGGTATAGAGGGGACCTGG + Intergenic
1092646560 12:10580505-10580527 TCCTGGGTGGAGTGGGGACTTGG + Intergenic
1094732894 12:33199108-33199130 TCCTGGGTGGAGTGGGGACTTGG + Intergenic
1096266839 12:50130216-50130238 AGGTGGGTTCAGTGGGGACCAGG + Exonic
1100089779 12:90955051-90955073 AGCCGGGTGTGGTGGGGACCCGG - Exonic
1100166151 12:91920477-91920499 AACTGGGTGTAGTGGGGACAGGG - Intergenic
1102652889 12:114455368-114455390 ATGAGGGTGGAGTGGGGCCCAGG - Intergenic
1105476311 13:20730639-20730661 TCCTGGGTCTAGTGGGGACTTGG + Intronic
1105520959 13:21130481-21130503 TCCTGGGTGGAGTGGGGACTTGG + Intergenic
1105676873 13:22681054-22681076 TCCTGGGTCTAGTGGGGACTTGG + Intergenic
1107728545 13:43324782-43324804 GCGTGGGTGTGGTGGGGAGCAGG - Intronic
1108848279 13:54700395-54700417 ACCTGGGTTGAGTGGGGACTTGG + Intergenic
1114248303 14:20934794-20934816 ACGTGGGGTTGGTGGGGAACAGG + Intergenic
1115268541 14:31526984-31527006 TCCTGAGTGTAGTGGGGACTTGG - Intronic
1120030145 14:79631654-79631676 TTTTGGGTGGAGTGGGGACCTGG + Intronic
1120335453 14:83148885-83148907 TCCTGGGTGGAGTGGGGACTTGG - Intergenic
1124385842 15:29207700-29207722 TCCTGGGTGGAGTGGGGACTTGG - Intronic
1124632421 15:31345226-31345248 ACAGGGGTGGAGTGGGGACTTGG + Intronic
1127019978 15:54735808-54735830 ACAGGGGTGTAGGGGGGTCCCGG - Intergenic
1131614910 15:94005952-94005974 TCCTGGGTGGAGTGGGGACTTGG + Intergenic
1131719195 15:95148707-95148729 TCCTGGGTGGAGTGGGGACTTGG - Intergenic
1132279445 15:100600832-100600854 AAGTGGGTGTAGGGTGGGCCTGG - Intronic
1132296380 15:100737753-100737775 GTGTGTGTGTAGTGGGGACAAGG - Intergenic
1133100979 16:3479607-3479629 ACGTGTGTGCAGTGAGGACTTGG + Intronic
1135939943 16:26813902-26813924 GCGTGGATGTAGTGTGGACATGG + Intergenic
1135939948 16:26813954-26813976 GCGTGGATGTAGTGTGGACATGG + Intergenic
1135939957 16:26814032-26814054 GCGTGGATGTAGTGTGGACATGG + Intergenic
1136221247 16:28830569-28830591 ACGTGGGTTTTGTGGCTACCTGG + Intronic
1138954000 16:61949237-61949259 TCCTGGGTGGAGTGGGGACTTGG + Intronic
1139790400 16:69429520-69429542 TCCTGGGTGGAGTGGGGACTTGG - Intronic
1140629476 16:76834228-76834250 AGATGGGTGCACTGGGGACCTGG - Intergenic
1141241172 16:82266636-82266658 AAGTGGGGGTAGTGGGGATGGGG - Intergenic
1144520726 17:15950836-15950858 AGGTGGGTGAAGTGAGGAACGGG - Intronic
1146305198 17:31725063-31725085 TCCTTGGTGTAGTGGGGACTTGG + Intergenic
1150317217 17:64179103-64179125 TCCTGGGTGGAGTGGGGACTTGG + Intronic
1152632007 17:81414634-81414656 ACGTGTGTGTCGTGAGGACGTGG + Intronic
1154040242 18:10847577-10847599 ACGTGGGTGTAGTGGGGACCGGG - Intronic
1155622214 18:27792762-27792784 ACGGGGGTGTTGGGGGGAGCTGG + Intergenic
1159505330 18:69328306-69328328 ACGTGCGTGTGGTGGGGAAGGGG - Intergenic
1160764184 19:799830-799852 ACCTGGCTGTGGAGGGGACCTGG + Intronic
1161580368 19:5077496-5077518 CTGTGGGTGAAGTGGGTACCGGG + Intronic
1164189599 19:22901907-22901929 ACTTGGCTGTAGGGTGGACCCGG + Intergenic
1166228870 19:41414026-41414048 CTGGGGGTGTAGAGGGGACCGGG - Intronic
1167161047 19:47767218-47767240 ACGTGGGTGGGGTGGGGAGAAGG - Intergenic
1167462931 19:49635851-49635873 ACCTGGGGGTAGGGGGGACACGG + Exonic
929254217 2:39791934-39791956 TCCTGGGTGGAGTGGGGACTTGG - Intergenic
931515971 2:63050945-63050967 ACGTGGAGGCAGTGGGGACTGGG - Intronic
934060803 2:88291046-88291068 TCTTGGGTGGAGTGGGGACTCGG + Intergenic
935675578 2:105592619-105592641 ATGTGGGTGTGCTGGGGCCCAGG - Intergenic
935761020 2:106320818-106320840 TCTTGGGTCAAGTGGGGACCTGG - Intergenic
936802076 2:116282438-116282460 TCCTGGGTCAAGTGGGGACCTGG + Intergenic
937050457 2:118884128-118884150 TCCTGGGTCTAGTGGGGACTTGG - Intergenic
937076716 2:119112656-119112678 ACGAGGTTGTCATGGGGACCAGG - Intergenic
937706592 2:124927770-124927792 TCGTGGGTCAAGTGGGGACTTGG + Intergenic
937732138 2:125245958-125245980 AGGTGGGTGCAGTGGGGAAGAGG - Intergenic
938129343 2:128697900-128697922 TCCTGGGTCGAGTGGGGACCTGG - Intergenic
938669469 2:133573340-133573362 ACATGTGTGTTGAGGGGACCAGG - Intergenic
938719801 2:134056443-134056465 ACTTGGGTGGAGTGGGTCCCTGG - Intergenic
942942904 2:181640309-181640331 ACGTGGGTGTGGTGAGCAACAGG - Intronic
947539280 2:230964164-230964186 TCCTGGGTTTAGTGGGGACTTGG - Intergenic
948981053 2:241494991-241495013 AGGTGTGTGTGGTGGGGCCCGGG - Exonic
1169263757 20:4155406-4155428 ACGTGGGAGTGGGGGGGGCCTGG + Intronic
1170333320 20:15239935-15239957 AAGTGTGTGTAGTGGGCCCCAGG - Intronic
1173465880 20:43280984-43281006 AGGTGGGGGTTGTGGGGACCTGG - Intergenic
1173732041 20:45335825-45335847 ATGAGGATGTAGTGGGGCCCGGG - Exonic
1173796483 20:45864385-45864407 ACGTGGGTGTCTTGGGGGACTGG + Intronic
1176671124 21:9735997-9736019 TCCTGAGTGTAGTGGGGACTTGG + Intergenic
1178162858 21:29939308-29939330 ACGCGGGTGTAGCGGGTCCCGGG - Intronic
1179891572 21:44338451-44338473 ACGTGGGTGCGGTGGGACCCAGG - Intronic
1179914389 21:44467005-44467027 ACCTGGCTGTACTGGGGAACGGG - Intergenic
1181235811 22:21447022-21447044 ACGTGGGTCTCGCTGGGACCTGG + Exonic
1182553186 22:31112927-31112949 TCCTGGGTGGAGTGGGGACTTGG - Intronic
1183740961 22:39668380-39668402 AGGTGGGTGTAGCTGGGACCAGG + Exonic
1184114869 22:42416605-42416627 AGGTGGGTGTAGAGGGGGCTGGG + Intronic
1184234348 22:43175042-43175064 ACGTGAGTCTTGTGGTGACCTGG - Intronic
1185339183 22:50284041-50284063 AGGTGGGCGCAGTGGGGAGCAGG - Intronic
950102469 3:10366363-10366385 AATGGGGTGTACTGGGGACCTGG + Intronic
950399505 3:12759563-12759585 ATGTGGGTGGAGGGGGTACCTGG - Intronic
950405311 3:12800580-12800602 AAGTGGGCCTAGTGGGGACCAGG + Intronic
950899626 3:16486069-16486091 AGGTGGGTGTGCTGGGCACCTGG - Intronic
952710708 3:36429456-36429478 ACCTGGGAGTGGTGGGGAACAGG + Intronic
953583909 3:44182419-44182441 AAGTGGGTATAGTGGGGAAGGGG + Intergenic
954232629 3:49229211-49229233 TCCTGGGTCTAGTGGGGACTTGG - Intronic
954717797 3:52534939-52534961 AAGTGGGTGTGCTGGGAACCTGG + Intronic
955098588 3:55824348-55824370 ACATGGGTGTTATGGGGGCCTGG - Intronic
956563715 3:70612274-70612296 TCCTGGGTCTGGTGGGGACCTGG + Intergenic
959502398 3:107121406-107121428 AAGTGTGTGAAGTGGGGAGCAGG - Intergenic
962351159 3:134656681-134656703 GCCTGGGTGAAGTGGGGAACTGG + Intronic
965703361 3:171481078-171481100 AAGTGTGTGTAGTGGGTACTGGG - Intergenic
974932243 4:68372514-68372536 AAGTGGGTGTAGTGGCATCCTGG + Intergenic
976405175 4:84654914-84654936 ACGTGGGTGCAGAGGAGACCTGG - Intergenic
982260247 4:153488402-153488424 CTGTGGGAGGAGTGGGGACCGGG + Intronic
982311767 4:153993448-153993470 AAGTGGGGGTTGGGGGGACCAGG - Intergenic
984930950 4:184846690-184846712 ACGTGGGATTAGTGGGAACCAGG + Intergenic
985509665 5:305715-305737 ACGTGTGTGGTGTGTGGACCAGG - Intronic
985664168 5:1173359-1173381 TCCTGGGTCTAGTGGGGACTTGG - Intergenic
989986302 5:50702892-50702914 ACATGGCTGTAGTGGTGACAGGG + Intronic
993802353 5:92358009-92358031 TCCTGGGTCCAGTGGGGACCTGG + Intergenic
996665769 5:126058468-126058490 TCCTGGGTCTAGTGGGGACTTGG + Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
999321689 5:150619164-150619186 ACGTGGGGGTGCTGGGGACGCGG + Intronic
1000541619 5:162548420-162548442 TCCTGGGTGGAGTGGGGACTTGG + Intergenic
1002348232 5:178563009-178563031 TCCTGGGTGCAGTGGGGACTTGG - Intronic
1002615571 5:180453019-180453041 TCCTGGGTGGAGTGGGGACTTGG + Intergenic
1003075329 6:2979048-2979070 ACGTGGGTGTAATGAGAACGAGG - Intergenic
1004045280 6:12017830-12017852 TCCTGAGTCTAGTGGGGACCTGG - Intronic
1004367593 6:15024912-15024934 TTGTGGGGGTAGTGGGGACAGGG + Intergenic
1006007906 6:31017260-31017282 TCCTGAGTGTAGTGGGGACTTGG + Intronic
1014691067 6:124564133-124564155 TCCTGGGTGGAGTGGGGACTTGG + Intronic
1020164001 7:5793955-5793977 TCCTGAGTCTAGTGGGGACCTGG + Intergenic
1020375268 7:7478445-7478467 TCCTGGGTCTAGTGGGGACTTGG - Intronic
1024995882 7:55272883-55272905 ACGTGATTGTATTGGAGACCGGG + Intergenic
1026137055 7:67672785-67672807 ACTTGGGTGTATTGGGTAACTGG + Intergenic
1034354896 7:150444220-150444242 CCGTGGGGGGAGTGGGGATCTGG - Intergenic
1039276557 8:35938866-35938888 TCCTGGGTGAAGTGGGGACCTGG + Intergenic
1043057124 8:75453229-75453251 TCCTGGGTGGAGTGGGGACTTGG + Intronic
1043703407 8:83319237-83319259 TCCTGGGTGGAGTGGGGACTTGG - Intergenic
1044126695 8:88467546-88467568 ATGTGGGTGGAGTGGGGACTGGG - Intergenic
1044794268 8:95880443-95880465 AGGTGGGTGTGGTGGGGATAAGG + Intergenic
1045497395 8:102719942-102719964 ACGTGGGTGGAATAGGCACCAGG - Intergenic
1048187269 8:132252816-132252838 TCCTGGGTCGAGTGGGGACCTGG - Intronic
1048307926 8:133296736-133296758 ACGTGGGTGCAGAAGGGACTAGG - Exonic
1049313329 8:141945670-141945692 ACGTGTGTGTATTGTGGAGCAGG + Intergenic
1049865713 8:144934189-144934211 ACGTGGGTGCAGTGGGTAGAGGG - Intronic
1051680334 9:19600982-19601004 TCCTGGGTCTAGTGGGGACTTGG + Intronic
1053860182 9:42378678-42378700 TCCTGGGTCCAGTGGGGACCTGG - Intergenic
1055241811 9:74195444-74195466 TCCTGGGTCGAGTGGGGACCTGG - Intergenic
1055748283 9:79474908-79474930 TCCTGGGTCGAGTGGGGACCTGG - Intergenic
1057001860 9:91517432-91517454 TCCTGGGTGGAGTGGGGACTTGG + Intergenic
1057275893 9:93675820-93675842 AGGTGGGGGTAGCAGGGACCTGG - Intronic
1057526178 9:95803935-95803957 TCTTGGGTCTAGTGGGGACTTGG + Intergenic
1057721843 9:97538127-97538149 ACGTGGGAGTGTTGGGGACTGGG - Intronic
1057920646 9:99093931-99093953 ACTTGGGTCCAGTTGGGACCAGG - Intergenic
1058905332 9:109478001-109478023 ACCTGGGTGTAGCAGGGGCCTGG + Intronic
1062422495 9:136489881-136489903 TCGTGGGTCAAGTGGGGACCTGG - Intergenic
1062466825 9:136685288-136685310 ACCTGGGTGTCCTCGGGACCTGG - Intronic
1187010459 X:15273208-15273230 TCCTGGGTGGAGTGGGGACTTGG + Intergenic
1187617520 X:21013703-21013725 GTGTGGGTGTAGTGGGGGCGAGG + Intergenic
1189356081 X:40310767-40310789 AGGTGGGTGGGGTGGGGCCCCGG - Intergenic
1191111417 X:56805585-56805607 TGGTGGGGGCAGTGGGGACCAGG + Intergenic
1191251215 X:58261057-58261079 CCGTGGGGGTTGTGGGAACCTGG + Intergenic
1194071521 X:89330929-89330951 TCCTGAGTCTAGTGGGGACCTGG - Intergenic
1195755110 X:108192288-108192310 ATGTGGGGGTAGTGAGGGCCTGG - Intronic
1196108296 X:111919129-111919151 TCCTGGGTCTAGTGGGGACTTGG + Intronic
1196312879 X:114189024-114189046 TCCTGGGTCTAGTGGGGACTTGG + Intergenic
1196378418 X:115061780-115061802 TCCTGGGTCTAGTGGGGACTTGG + Intergenic
1197978836 X:132194546-132194568 TCCTGAGTGTAGTGGGGACTTGG + Intergenic
1200420139 Y:2956268-2956290 ACCTGGGAGTAGTGGGGTTCGGG + Intronic
1200502363 Y:3966881-3966903 TCCTGGGTCTAGTGGGGACTTGG - Intergenic
1201913275 Y:19155447-19155469 TCCTGGGTCTAGTGGGGACTTGG + Intergenic
1202082398 Y:21097563-21097585 TCCTGGGTCAAGTGGGGACCTGG - Intergenic