ID: 1154040651

View in Genome Browser
Species Human (GRCh38)
Location 18:10852410-10852432
Sequence CTGAATTTAAGTGGTCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154040649_1154040651 -3 Left 1154040649 18:10852390-10852412 CCAACTTTTACTTATTTTAACTG 0: 1
1: 0
2: 1
3: 43
4: 578
Right 1154040651 18:10852410-10852432 CTGAATTTAAGTGGTCTTAAAGG 0: 1
1: 0
2: 0
3: 6
4: 165
1154040648_1154040651 3 Left 1154040648 18:10852384-10852406 CCAGCACCAACTTTTACTTATTT 0: 1
1: 0
2: 2
3: 35
4: 345
Right 1154040651 18:10852410-10852432 CTGAATTTAAGTGGTCTTAAAGG 0: 1
1: 0
2: 0
3: 6
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154040651 Original CRISPR CTGAATTTAAGTGGTCTTAA AGG Intronic
900010873 1:106862-106884 CAAAATCTAAGTAGTCTTAAAGG - Intergenic
900026975 1:283426-283448 CAAAATCTAAGTAGTCTTAAAGG - Intergenic
908091542 1:60690923-60690945 CAGAATATACATGGTCTTAATGG - Intergenic
909901376 1:81140569-81140591 CTCAATTTGAGTGGTGTGAAAGG - Intergenic
911475896 1:98371890-98371912 CTGAATTTTATTGCTCTTGATGG - Intergenic
911594726 1:99787180-99787202 CTGAGATTAAGTGGTCTGTAAGG - Intergenic
914402321 1:147334143-147334165 CTGAATTCAAGTGCCCTTCAAGG + Intergenic
919041141 1:192390287-192390309 CTAAGTTTAGGTGGTCCTAAGGG + Intergenic
919358845 1:196563962-196563984 CTGAATTTAAGTGGCAAGAATGG - Intronic
919587248 1:199454369-199454391 CTGAATTTTAATGTTCTTAGTGG - Intergenic
921896720 1:220409611-220409633 GTGAGTTTGAGTGGTCTTCAGGG - Intergenic
922259319 1:223922869-223922891 CAAAATCTAAGTAGTCTTAAAGG - Intergenic
924340499 1:243025615-243025637 CAAAATCTAAGTAGTCTTAAAGG - Intergenic
924410431 1:243798918-243798940 CAGAATTTAAGTCATCTAAAAGG - Intronic
1062990965 10:1817295-1817317 CTGAACTTAATTGTTTTTAATGG + Intergenic
1066497675 10:35958098-35958120 CTGAATTAAAGAGGTATTAGTGG - Intergenic
1066625321 10:37400190-37400212 CTGATTTAAAGTGGTATTAGTGG - Intergenic
1066735999 10:38479984-38480006 CTAAATCTAAGTAGTCTTAAAGG + Intergenic
1069207471 10:65709697-65709719 CTGACTTTAAGTGGGCATGAGGG + Intergenic
1070725679 10:78786916-78786938 ATGAATTTAAGTGGTATCATGGG + Intergenic
1073631187 10:105150809-105150831 CTCAATTTAATTGGTCTCTAGGG + Intronic
1073719965 10:106157365-106157387 CAGATTTTAAGTGGTGTGAATGG - Intergenic
1073911915 10:108355908-108355930 CGGAATTTAGTTGGTCTTATTGG - Intergenic
1078696642 11:13639621-13639643 GTTAATTTTAGTGGTTTTAATGG + Intergenic
1081860272 11:46329464-46329486 AGGAATTTAAGTGATCTTCAGGG + Intergenic
1082797684 11:57389759-57389781 CTGAATTTCTGTGTGCTTAAAGG - Intronic
1085169917 11:74440949-74440971 CTGAAATAAAGTGATCTAAATGG + Intergenic
1085727376 11:78965870-78965892 TTGAATTTAAGTGGTTTCCAAGG + Intronic
1086941706 11:92804865-92804887 TTGAATTTGATTGTTCTTAAGGG + Intronic
1090337300 11:125980281-125980303 CTGAAATAAGGTTGTCTTAAGGG + Intronic
1091915026 12:4265666-4265688 TAGAATTTAAGTGGTTTTAATGG - Intergenic
1092037821 12:5354723-5354745 TTGAATGTAAGTGGTGATAATGG - Intergenic
1092979315 12:13777711-13777733 CTGAATATCAGTGTTCTTTAGGG - Intronic
1093381311 12:18497492-18497514 CTGACTTAGAGTGGTTTTAATGG - Intronic
1097532326 12:60819301-60819323 CTGAATATAAGTGGTACAAAAGG - Intergenic
1097888218 12:64751307-64751329 CTGAATTCTAGTGATTTTAAAGG + Intronic
1099775834 12:87128342-87128364 CTGCATTTAAGTGTTTATAAAGG + Intergenic
1100809211 12:98321545-98321567 CTGAATACAAGTGGTGCTAATGG - Intergenic
1101238937 12:102818756-102818778 CTGACATTAAATGGTTTTAATGG - Intergenic
1101365128 12:104064213-104064235 CTCAATTAAAGTGGACGTAAAGG + Intergenic
1103150404 12:118633370-118633392 CTGAATTTAAATGTTTTTAGAGG + Intergenic
1106055195 13:26230787-26230809 CAGTAATTAAGTGGTTTTAATGG + Intergenic
1106362906 13:29049189-29049211 GTGAATTTAAATGTTATTAATGG + Intronic
1107928899 13:45289940-45289962 TTATATTTAAGTGGTCTCAAGGG + Intergenic
1115349708 14:32380777-32380799 CTGACTACAAGTGGTTTTAATGG - Intronic
1119191898 14:72688601-72688623 CTGCATTTAAGTAGTCACAATGG + Intronic
1120346381 14:83296024-83296046 CTGATTTTAAATAGTTTTAAAGG - Intergenic
1120779974 14:88478713-88478735 TTGAATTTTAGTGGTTTTACTGG - Intronic
1122506219 14:102233496-102233518 ATCACTTTAAGTGGTCTCAAAGG - Intronic
1124040684 15:26100106-26100128 CTGGATTTATGTGTTTTTAATGG + Intergenic
1125801698 15:42454117-42454139 CTGACTTTAATTGGCTTTAAAGG + Intronic
1127667381 15:61161806-61161828 CTGTTTTTAAGTGGCCTTCACGG - Intronic
1127826227 15:62705896-62705918 CAAAAACTAAGTGGTCTTAAAGG - Intronic
1128869409 15:71141629-71141651 CTTAAAGTAAGTGATCTTAAGGG + Intronic
1128986278 15:72224056-72224078 CTGAAGTTGAGTGGTCTTTGAGG - Intronic
1132033580 15:98459639-98459661 CTGAATGTAAATGGCCTAAATGG + Intronic
1140625359 16:76787795-76787817 CTGAATAAAAGTGTTCCTAATGG - Intergenic
1142453474 16:90200054-90200076 CAAAATCTAAGTAGTCTTAAAGG + Intergenic
1144195092 17:12885590-12885612 CTTAATTTACATTGTCTTAAGGG + Intronic
1148545900 17:48518871-48518893 CTGGATTTGAGTGTTCTGAATGG + Intergenic
1149174170 17:53849466-53849488 GTGAATTTAAATGGGCTAAAAGG - Intergenic
1149476694 17:56966990-56967012 TTGTATTTAAAAGGTCTTAATGG + Intergenic
1153152903 18:2114813-2114835 CCGAATGTAAGTTGTGTTAAAGG + Intergenic
1153416579 18:4852434-4852456 TTGAAGTCAAGTGGTTTTAAAGG - Intergenic
1154040651 18:10852410-10852432 CTGAATTTAAGTGGTCTTAAAGG + Intronic
1156090301 18:33460184-33460206 CTGAAATTAATTGGATTTAAAGG + Intergenic
1156674463 18:39511255-39511277 CTGAATTTAAGAGGTAGGAAAGG + Intergenic
1163609608 19:18294133-18294155 CTGAATTTGAGGTGTGTTAAGGG + Intergenic
925915591 2:8602824-8602846 CTTTCTTTAAGTGGTCCTAACGG - Intergenic
930618192 2:53615933-53615955 CTGAGTTAAACTGGACTTAAGGG - Intronic
931844462 2:66188689-66188711 CTGAATTTGAATGGTTTTGATGG + Intergenic
932843214 2:75104390-75104412 ATTAATTTAATGGGTCTTAAGGG + Intronic
934497628 2:94822595-94822617 CTGAGTTAAAGTAGTGTTAAAGG - Intergenic
935129937 2:100254252-100254274 TTGTATTTAAGTTGTCTTAAGGG + Intergenic
935666909 2:105520238-105520260 CTGACTTTGAGTGTTCTCAAGGG + Intergenic
937286592 2:120758013-120758035 CTGATTTTAAGTGGTGTGAGTGG + Intronic
938586517 2:132695872-132695894 CTGAAATTAGATGCTCTTAAAGG - Intronic
941304086 2:163839563-163839585 CTTATCTTAAGTGGTCTTTATGG + Intergenic
941410707 2:165154065-165154087 CTGAAGTTAATTGATTTTAAAGG - Intronic
945305919 2:208258632-208258654 TTGTATTTAAGTGATATTAATGG - Intronic
946681669 2:222223396-222223418 CTGAAATTAAGTGCTGTTCATGG - Intronic
946898596 2:224350657-224350679 CTCAAATGGAGTGGTCTTAAAGG - Intergenic
946956859 2:224940435-224940457 TTGGATTTGAATGGTCTTAAAGG + Intronic
949084917 2:242144703-242144725 CAAAATCTAAGTAGTCTTAAAGG + Intergenic
1169211693 20:3769272-3769294 GTAAATTTATGTGCTCTTAAAGG - Intergenic
1169409632 20:5356561-5356583 CTAAAATTAAGTTGTCTTCAGGG - Intergenic
1171888919 20:30689343-30689365 CTGAGTTAAAGTAGTGTTAAAGG - Intergenic
1175863991 20:62164914-62164936 ATAAAATAAAGTGGTCTTAAAGG + Intronic
1177293757 21:19148806-19148828 CTTAATTTAAGTAGTGGTAATGG - Intergenic
949102921 3:167619-167641 CTGTATTTTAGTGGTCGTAGTGG - Intergenic
952083060 3:29783707-29783729 TTGAATGTAAGTGGCCTAAATGG + Intronic
953421323 3:42755701-42755723 CTGGATTTAAGTGGTTTTCAGGG + Intronic
956387207 3:68732712-68732734 TTGTATTAAAGTGGTTTTAAAGG - Exonic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
958427402 3:93994877-93994899 CAGAATTTAAATGGCCGTAAAGG - Intronic
962784167 3:138751146-138751168 CTGTATTTAAGAGATCTTTATGG - Intronic
965819149 3:172667077-172667099 CTGATTTTTAGTGGTGTGAAAGG - Intronic
967748595 3:193087613-193087635 CAGAATTTCAGTGGTCATAATGG + Intergenic
972019611 4:34294949-34294971 CTGAATTTTAGTGGTATTTCTGG + Intergenic
975241342 4:72063668-72063690 CTGAATTAAAGTGGGCTGACTGG - Intronic
975335711 4:73172971-73172993 CTGAATGTAAATGGACTTAAAGG + Intronic
975999669 4:80358801-80358823 CTGAATGTAAATGGGCTAAAAGG - Intronic
976316331 4:83663139-83663161 CTGAATTTCACTGTTTTTAAAGG + Intergenic
977614453 4:99072479-99072501 CACAATTTTAGTTGTCTTAAAGG - Intronic
977716103 4:100185598-100185620 CTGAATATGAGTGGACTGAAAGG - Intergenic
977935222 4:102794416-102794438 CTGAAGTTAATTGAGCTTAAAGG - Intronic
978171807 4:105680433-105680455 TAGAATTTAAGTGGTATGAATGG - Exonic
978486194 4:109256467-109256489 CTGAATTTTTGTGATCTCAAAGG + Intronic
979262351 4:118662946-118662968 CAAAATCTAAGTAGTCTTAAAGG + Intergenic
979740201 4:124140081-124140103 CTGAATGTAAGTTTTGTTAAAGG + Intergenic
979841219 4:125443017-125443039 GTGAATTTAAGTGCTATTCATGG + Intronic
980203025 4:129679810-129679832 CTGAATTCAAATGGTCTCAGAGG + Intergenic
980328298 4:131377113-131377135 CTATATTTAACTGATCTTAAAGG + Intergenic
981328463 4:143479788-143479810 CTGAATAGAAGTGGTGATAATGG - Intergenic
981597537 4:146444825-146444847 CTGATTTCACGTGGTCTTCAGGG - Intronic
982750811 4:159158969-159158991 CTCACTTTATTTGGTCTTAACGG + Intronic
983010012 4:162536350-162536372 CTTAATTAAAGTGGCCTTTAAGG - Intergenic
983149487 4:164260383-164260405 CAAAATCTAAGTAGTCTTAAAGG - Intronic
983409953 4:167383530-167383552 CTGAAGTTGATTGCTCTTAAAGG - Intergenic
985292545 4:188401337-188401359 ATGAAATTAAGTAGTCTTAGTGG + Intergenic
985351129 4:189062317-189062339 CTGAATTAAGGAGGTCATAAAGG - Intergenic
985855659 5:2423853-2423875 CTAAATGTAAATGGTCTAAAAGG - Intergenic
988623418 5:32846531-32846553 CTGAATTTACCTGGGTTTAAGGG - Intergenic
993387289 5:87275160-87275182 GGGTATTTAAGTGTTCTTAAAGG - Intronic
995308766 5:110687494-110687516 CTGAAATTAAAGGGTCTGAAAGG - Intronic
996530637 5:124523345-124523367 CACATTTTAAGTGGTCTAAAAGG - Intergenic
996602781 5:125285579-125285601 CTAAATTTAACTGGTTTGAATGG - Intergenic
996946064 5:129069416-129069438 CAGAACTTAAATGTTCTTAAGGG - Intergenic
997628164 5:135345435-135345457 CTGAATTTAGGTGGTCATTTGGG - Intronic
998946111 5:147341101-147341123 CTGAATTTATGAGGACTTACTGG - Intronic
1008430894 6:51415432-51415454 CTGTAACTAGGTGGTCTTAATGG - Intergenic
1008720136 6:54339058-54339080 CTCAATTTCAGAGGTGTTAATGG - Intronic
1009485424 6:64216480-64216502 TTGAATTCAAGTGGTCATAGGGG + Intronic
1013881356 6:114905381-114905403 CTAAATTTAAGTAGTCAAAATGG + Intergenic
1014236322 6:118959414-118959436 TTGATTTTAATTTGTCTTAAAGG - Intergenic
1015739453 6:136437903-136437925 ATGAATTTAGGTAGTCATAAAGG - Intronic
1015739740 6:136441304-136441326 TTGCATATAAGTGGTTTTAATGG - Intronic
1017141535 6:151195104-151195126 CTGAATAGAAGTGGTGTTAGTGG - Intergenic
1017586237 6:155927638-155927660 CTGAATATAAGTGGTGAGAATGG + Intergenic
1017799806 6:157884224-157884246 TTGAAGTTAAGTGGTATTTAAGG + Intronic
1026156053 7:67826788-67826810 CTCACTTTAGGTGGTCTTAGAGG - Intergenic
1028571214 7:92289629-92289651 ATGATTTCAACTGGTCTTAAGGG - Intronic
1032816452 7:135479951-135479973 CAGAATTTAATTAGTTTTAAAGG - Intronic
1033169704 7:139072713-139072735 CTGGATTTAGATGGACTTAAAGG - Intronic
1033587249 7:142783179-142783201 CTGAATTTAAGGAGTCTTGGGGG + Intergenic
1034247039 7:149653303-149653325 CTGAATTTATGTGTTCTAATAGG - Intergenic
1037143913 8:15550293-15550315 CTGAATTCAAGTGCCATTAAGGG - Intronic
1038277389 8:26133310-26133332 CTGAATTGAAGTGGTTGAAATGG + Intergenic
1041042267 8:53859419-53859441 CAGATTTTAAATGGTTTTAATGG + Intronic
1041055931 8:53985864-53985886 CTGAATTTAAGTTGTGCAAAAGG - Intronic
1042093323 8:65183315-65183337 CTAAATTGCAGTGGTCTGAAAGG + Intergenic
1043575453 8:81651283-81651305 TTGGATTTCAGTTGTCTTAAAGG - Intergenic
1044177174 8:89141458-89141480 TTGAATTAAAGTGGTGATAATGG + Intergenic
1044892626 8:96853635-96853657 CTGAATTTACGTGTTTTGAAAGG + Intronic
1046734209 8:117758853-117758875 CTGAATTTGCATGGTCTTGAAGG + Intergenic
1047022369 8:120788397-120788419 TTGAATGTAAATGGTCTAAATGG + Intronic
1047030482 8:120873946-120873968 CTCAAGTTATCTGGTCTTAAGGG + Intergenic
1054788031 9:69228120-69228142 TTGAAACTGAGTGGTCTTAATGG - Intronic
1058560817 9:106226985-106227007 CTGAATTTCAGTGTTGTTAGTGG + Intergenic
1058772414 9:108248486-108248508 CTGATTTTACTTGATCTTAATGG + Intergenic
1059979050 9:119749041-119749063 CTGAACTTAAATGGAATTAATGG + Intergenic
1186867605 X:13735537-13735559 TTGAGTTTGAGTCGTCTTAAAGG + Intronic
1187022889 X:15402973-15402995 CTGAGTTGTAGTGGACTTAAAGG - Intronic
1187197399 X:17100670-17100692 TTGAATTTAAATGGTGATAATGG - Intronic
1192594881 X:72395953-72395975 CTGATTTTAAGTCTGCTTAAGGG - Intronic
1193291972 X:79785187-79785209 CTGAATTTAACTGGTCAGTAAGG + Intergenic
1193440036 X:81528966-81528988 CTGAATTTACATGGACTCAAAGG - Intergenic
1193980900 X:88180733-88180755 CTGAAGTTAGGTGGTCTCAGAGG + Intergenic
1197695893 X:129549542-129549564 GTGAATTTTAGAAGTCTTAAAGG + Intronic
1198256715 X:134930553-134930575 CTGAATTAAAGTGGTAGTAGGGG - Intergenic
1199914400 X:152323163-152323185 CTTAATTAAAGTCATCTTAATGG + Intronic
1201307836 Y:12566031-12566053 TTGAATGTAAGTGGCCTAAATGG - Intergenic