ID: 1154041442

View in Genome Browser
Species Human (GRCh38)
Location 18:10859944-10859966
Sequence GCAGCTAGGAAGTTTAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 774
Summary {0: 1, 1: 1, 2: 1, 3: 48, 4: 723}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154041436_1154041442 17 Left 1154041436 18:10859904-10859926 CCTGTCTTTGGAGTCTGTTTTGG 0: 1
1: 0
2: 4
3: 16
4: 230
Right 1154041442 18:10859944-10859966 GCAGCTAGGAAGTTTAAAGTGGG 0: 1
1: 1
2: 1
3: 48
4: 723

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154041442 Original CRISPR GCAGCTAGGAAGTTTAAAGT GGG Intronic
903795523 1:25926300-25926322 GCAGCTTGGAAGATTGAGGTGGG + Intergenic
905178280 1:36151497-36151519 GCTACTAGGAAGGTTAAGGTGGG + Intronic
905355456 1:37380719-37380741 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
905485185 1:38291108-38291130 GCACCTTGGAAGTCCAAAGTGGG - Intergenic
906570123 1:46830828-46830850 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
907995041 1:59622250-59622272 GAAGATAAGAATTTTAAAGTAGG - Intronic
908639315 1:66204495-66204517 GCAGCCAGGAAGCTCAAACTGGG - Intronic
908975134 1:69888145-69888167 GCAGCCAGGAAGCTCAAACTGGG - Intronic
908977054 1:69910849-69910871 GCAGCCAGGAAGCTCAAACTGGG - Intronic
909441203 1:75698117-75698139 GCAGCTTGGAAGCTCAAATTGGG + Intergenic
909807902 1:79894252-79894274 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
910381321 1:86629995-86630017 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
910482637 1:87675178-87675200 GCAAGTAGGAAATTTTAAGTAGG + Intergenic
910618817 1:89230439-89230461 GCGGCCAGGAAGTTTGAACTAGG - Intergenic
910627668 1:89325613-89325635 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
910805715 1:91188404-91188426 GCTGCTGGGAAGTTTGAACTGGG - Intergenic
910819390 1:91329490-91329512 GCAGCAAGGAAGTTTAAAAGGGG + Intronic
911033055 1:93510076-93510098 GCAGCCAGGAAGCTCAAACTGGG + Intronic
911291049 1:96057232-96057254 GCAGCTGGGAAGCTCAAACTGGG - Intergenic
911541341 1:99161975-99161997 GTAGCCAGGAAGTTCAAATTGGG - Intergenic
912403990 1:109421073-109421095 GCTGCTAGGGAGGTTAAGGTGGG + Intronic
913299729 1:117358226-117358248 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
913337385 1:117721149-117721171 GCAGCTGGGAAGCTCGAAGTGGG + Intergenic
913434414 1:118831911-118831933 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
913704129 1:121401925-121401947 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
914458072 1:147855224-147855246 GCCGCTGGGAAGTTCAAAATGGG + Intergenic
914854001 1:151336866-151336888 CCAGCTAGAATGTTTAAAGTTGG + Intergenic
915336606 1:155146764-155146786 GCAGCTTGGGAGTTAAAAATTGG + Intergenic
915644059 1:157254423-157254445 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
915872350 1:159574608-159574630 GCAGCTAGGAAGCTCGAACTGGG - Intergenic
915886811 1:159730919-159730941 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
915992247 1:160529713-160529735 GCTGCCAGGAAGTTTGAACTGGG - Intergenic
916154659 1:161832749-161832771 GCAGCTGGGAAGCTTGAACTGGG + Intronic
917163509 1:172084629-172084651 GTAGCTATAAATTTTAAAGTTGG + Intronic
917181455 1:172302359-172302381 GCAGCTGGGAAGCTTGAAGTGGG + Intronic
917259746 1:173154209-173154231 GCAGCCAGGAAGTTCAAACTGGG + Intergenic
918593136 1:186262238-186262260 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
919147987 1:193659125-193659147 GCAGGTAAGAACATTAAAGTTGG + Intergenic
920035590 1:203063347-203063369 GAAGCAAGGAAGTTAAATGTTGG - Intronic
920589886 1:207207214-207207236 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
921626201 1:217380042-217380064 GCCGCTGGGAAGTTCAAACTGGG + Intergenic
921916010 1:220611229-220611251 GCAGCCAGGAAGCTTGAACTGGG - Intronic
922888928 1:229045749-229045771 GCAGATAGAAAGTTGAAAGGGGG + Intergenic
923690891 1:236192085-236192107 GCCGCTGGGAAGTTCAAACTGGG - Intronic
924109487 1:240683955-240683977 GCAGTTAGGAGGTTAAAAGGAGG + Intergenic
924254601 1:242169809-242169831 GCAGCCAGGAAGTTCGAACTGGG + Intronic
1063632791 10:7749746-7749768 GCTGCTAGGGAGGTTGAAGTGGG - Intergenic
1063796694 10:9520353-9520375 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1064624054 10:17244154-17244176 GCACCCAGGAAGCTAAAAGTTGG - Intergenic
1064761702 10:18627872-18627894 GCAGCTAGGAAGCTCCAACTGGG + Intronic
1064825879 10:19400127-19400149 GGAGCTTGTGAGTTTAAAGTGGG + Intronic
1065080957 10:22129439-22129461 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1065157047 10:22881117-22881139 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
1065236592 10:23658671-23658693 GGAGCTAGGCCTTTTAAAGTAGG - Intergenic
1065473061 10:26103048-26103070 GCAGCTGGGAAGCTCGAAGTGGG - Intronic
1066030865 10:31422291-31422313 GAAGCTATGAAGTAGAAAGTAGG + Intronic
1066139359 10:32488132-32488154 GCAGCCAGGAAGCTCAAACTGGG - Intronic
1066168562 10:32816330-32816352 GCAGCCAGGAAGCTCAAACTGGG + Intronic
1066639212 10:37538461-37538483 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
1067172555 10:43920423-43920445 GCAGCCAGGAAGCTAAAACTGGG - Intergenic
1067195237 10:44112397-44112419 GCAGCCAGGAAGTTCCAACTGGG - Intergenic
1067343161 10:45420107-45420129 GCATTTGGGAAGTTAAAAGTGGG - Intronic
1067903124 10:50262875-50262897 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1067904308 10:50274835-50274857 GCTACTAGGAAGGTTGAAGTGGG + Intergenic
1068115766 10:52736028-52736050 GCAGCCAGGAAGCTGAAACTGGG - Intergenic
1069066799 10:63950292-63950314 GCAGCCAGGAAGCTCAAACTAGG - Intergenic
1069139912 10:64810198-64810220 GCCGCCAGGAAGTTTGAACTAGG - Intergenic
1069227171 10:65959040-65959062 GCAGCCAGGAAGCTCAAACTGGG - Intronic
1069325908 10:67231139-67231161 GCAGCTGGGAAGCTCAAACTGGG + Intronic
1069861888 10:71476619-71476641 ACAAATAGGAAGTTGAAAGTAGG - Intronic
1070003102 10:72395769-72395791 GCAGCTGGGAAGCTCAAACTGGG + Intronic
1071077538 10:81772741-81772763 GCAGCTGGGAAGCTCAAACTGGG - Intergenic
1071213398 10:83370524-83370546 GCACCTAGGATGTTTGTAGTAGG + Intergenic
1071244399 10:83746851-83746873 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1072305109 10:94099894-94099916 ACAAATAGGAAGTTTAAAGAGGG - Intronic
1072384916 10:94914770-94914792 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1072876198 10:99175497-99175519 GCAGCTAGGAAGTTCCAACTGGG + Intronic
1075490792 10:122867285-122867307 GCAGCTGGGAAGATTGAACTGGG + Intronic
1075652377 10:124136800-124136822 GCTCCTAGGAAGGCTAAAGTGGG + Intergenic
1075973772 10:126676932-126676954 GCAGCGAGGAAGTTCGAACTGGG + Intergenic
1077714743 11:4569560-4569582 GGAGCTGGGAAGTATAGAGTGGG - Intergenic
1077741793 11:4854556-4854578 GCAGCCTGGAAGTTCAAACTGGG + Intronic
1077784968 11:5373818-5373840 GCAGCCAGGAAGCTCAAACTGGG + Intronic
1077857566 11:6144124-6144146 GCAGCTGGGAAGTTCCAACTGGG + Intergenic
1077950751 11:6954389-6954411 GCAGCCAGGAAGCTTGAACTGGG - Intronic
1078032247 11:7764583-7764605 GCAGCTGGGAAGTTCGAACTGGG + Intergenic
1078482649 11:11692007-11692029 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
1078793603 11:14569702-14569724 GCAGCCAGGAAGCTTGAACTGGG + Intronic
1078809409 11:14743324-14743346 GCTGCTGGGAAGTTCAAACTGGG - Intronic
1079037542 11:17034154-17034176 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
1079517885 11:21289869-21289891 GCTGCCAGGAAGTTCAAACTGGG + Intronic
1079653977 11:22965565-22965587 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1079799768 11:24854385-24854407 GCTGCTGGGAAGTTTGAACTGGG - Intronic
1079859523 11:25649298-25649320 GCAGCTGGGAAGCTCAAACTGGG - Intergenic
1079998543 11:27321602-27321624 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1080081364 11:28222200-28222222 GCAGCTGGGAAGCTCAAACTGGG - Intronic
1080088306 11:28314010-28314032 GCAGGTAGGAAAATAAAAGTTGG + Intronic
1080489458 11:32747585-32747607 GCAGCAAGGAAGCTTGAACTGGG - Intronic
1081080190 11:38731856-38731878 GCAGCTGGGAAGTTCAAAATGGG - Intergenic
1081308745 11:41545186-41545208 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1081506301 11:43720732-43720754 GCACCTAGTAAGTTTAAACTTGG + Intronic
1081697736 11:45127997-45128019 GCAGCCAGGAAGCTCGAAGTGGG - Intronic
1082117844 11:48346458-48346480 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1082150618 11:48734467-48734489 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1082249604 11:49963850-49963872 GCTGCTGGGAAGTTTGAACTGGG + Intergenic
1082321613 11:50818868-50818890 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
1082670719 11:56033502-56033524 GCTGCCAGGAAGTTTGAACTGGG + Intergenic
1083065412 11:59918297-59918319 GCAGGTAAAAAGTTTAATGTAGG - Intergenic
1083313198 11:61796475-61796497 GCAGCAGGGAAGTTTAAAAGGGG + Exonic
1084796793 11:71511519-71511541 GCAGCTGGGAAGCTCAAACTGGG + Intronic
1085247999 11:75119771-75119793 GCAGCTGGGAAGCTTGAACTGGG + Intronic
1086142833 11:83518168-83518190 GCAGCTGGGAAGCTCAAACTGGG - Intronic
1086416999 11:86598438-86598460 GCAGCCAGGAAGCTCAAACTGGG + Intronic
1086422501 11:86651088-86651110 GCAGCTGGGAAGCTCAAACTGGG + Intronic
1086567263 11:88240974-88240996 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
1086869058 11:92015194-92015216 GCAGCTGGGAAGCTCAAACTGGG - Intergenic
1089105972 11:116005396-116005418 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
1090579115 11:128140530-128140552 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1091052314 11:132383899-132383921 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1091317801 11:134627039-134627061 GCAGCTTGTAAATTTAAAGCTGG + Intergenic
1092079012 12:5697949-5697971 GCAGCCAGGAAGCTCAAACTGGG + Intronic
1092332169 12:7594589-7594611 GCTGCTGGGAAGTTTGAACTGGG + Intergenic
1093545029 12:20336374-20336396 GCCGCCAGGAAGTTCAAACTGGG - Intergenic
1093564955 12:20590923-20590945 GGAGCTAGGACGTGCAAAGTGGG - Intronic
1093802333 12:23389160-23389182 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1094377844 12:29810204-29810226 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1094453320 12:30604539-30604561 GAAGCCAGGAAGTTTGAACTGGG + Intergenic
1094733102 12:33200629-33200651 GCAGCCAGGAAGTTTGAACTTGG - Intergenic
1094735359 12:33228042-33228064 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
1094779396 12:33773345-33773367 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1095073845 12:37892882-37892904 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
1095165686 12:38969117-38969139 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
1095591314 12:43906960-43906982 GCAGCTGGGAAGCTTGAACTGGG + Intronic
1095911142 12:47427381-47427403 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1095913925 12:47457446-47457468 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
1097149559 12:56966470-56966492 GCAGCTGGGAAGCTTGAAATGGG + Intergenic
1097376428 12:58848580-58848602 GCAATTAGGTAGTCTAAAGTGGG - Intergenic
1097635178 12:62113756-62113778 GCCGCCAGGAAGTTTAAACTGGG - Intronic
1098057333 12:66521994-66522016 GCAGCTGGGAAGCTCAAACTGGG + Intronic
1098186359 12:67900687-67900709 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1098494489 12:71118550-71118572 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1098704616 12:73671780-73671802 GCAGCCAGGAAGTTTGAAATGGG + Intergenic
1100439700 12:94605194-94605216 GAAGCCAGGAATTTTAAAGCAGG + Intronic
1100563847 12:95775675-95775697 GCAGCTGGGAAGCTTGAACTGGG + Intronic
1100652972 12:96610881-96610903 GCAGCTGGGAAGTTCGAACTGGG + Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1105351153 13:19617386-19617408 GCAGCTGGGAAGCTCAAACTGGG - Intergenic
1106377422 13:29203275-29203297 GCTGCTGGGAAGTTCAAACTGGG - Intronic
1106595818 13:31135470-31135492 GCAGCTAGAAATTATAAAGTAGG + Exonic
1106617275 13:31341066-31341088 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
1107971336 13:45645508-45645530 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1109187914 13:59292075-59292097 GCTGCTGGGAAGTTCAAACTGGG + Intergenic
1109216077 13:59591116-59591138 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1109277703 13:60321031-60321053 GCAGATAGAATGTTGAAAGTAGG + Intergenic
1109659153 13:65435868-65435890 GCAGCTAGGAATCTTGAACTGGG + Intergenic
1109972003 13:69782654-69782676 GCAGCCAGGAAGCTCAAACTGGG + Intronic
1110876528 13:80517324-80517346 GCAGCTGGGAAGCTTAAACTGGG + Intergenic
1111598027 13:90435440-90435462 TAAGCTAGGAGGTTTAGAGTTGG + Intergenic
1111627965 13:90813570-90813592 GCAGCCAGGAAGTTTGGACTGGG + Intergenic
1111676321 13:91394122-91394144 GCAGCTTGGGAGGCTAAAGTAGG - Intergenic
1112694427 13:101931812-101931834 ACATGTAGGAAGTTTAAAATGGG - Intronic
1112767803 13:102763859-102763881 GCAGATAGAAAATTGAAAGTTGG + Intergenic
1112835392 13:103508149-103508171 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
1112899960 13:104346007-104346029 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
1114432874 14:22677687-22677709 GCAGCTGGGAAGCTTGAACTAGG - Intergenic
1114749171 14:25183901-25183923 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1114964382 14:27939422-27939444 GCAGCCAGGAAGTTTGAACTGGG + Intergenic
1115123121 14:29961018-29961040 GCAGCCAGGAAGCTTGAACTGGG - Intronic
1115277051 14:31621046-31621068 GCCGCCAGGAAGTTTGAAGTGGG - Intronic
1116268215 14:42724242-42724264 GAAGCAAGGAAGCTTAAAGGGGG + Intergenic
1117414686 14:55483857-55483879 TCATGTAGAAAGTTTAAAGTAGG + Intergenic
1117892670 14:60443511-60443533 GCAGCCAGGAAGCTTGAACTGGG + Intronic
1119827291 14:77668011-77668033 GCACCTTGGAAGTTCAAAGCAGG - Intergenic
1119883907 14:78124199-78124221 GGAGCTAGGAAGTATCAGGTGGG - Intergenic
1119909632 14:78337859-78337881 GCAGCAATGAAGTATATAGTTGG + Intronic
1120065780 14:80039264-80039286 GCAGCTGGGAAGCTTAAACTGGG + Intergenic
1120130899 14:80806558-80806580 GCAACTCTGATGTTTAAAGTAGG + Intronic
1120271764 14:82321853-82321875 GCTGCGAGGAAGTTTGAACTGGG - Intergenic
1120559629 14:85974713-85974735 GCAGCTAGGAAGCTCGAACTGGG - Intergenic
1120959273 14:90109818-90109840 GCTGCTCGGAAGGTTGAAGTGGG - Intronic
1202846646 14_GL000009v2_random:183483-183505 GCAGCCAGGAAGTTCGAACTGGG - Intergenic
1202916111 14_GL000194v1_random:174086-174108 GCAGCCAGGAAGTTCGAACTGGG - Intergenic
1202876658 14_KI270722v1_random:8961-8983 GCAGCCAGGAAGTTCGAACTGGG + Intergenic
1125227189 15:37408532-37408554 GCTGCTGGGAAGTTCAAACTGGG + Intergenic
1125329989 15:38573331-38573353 GCCGCTAGGAAGTTCGAACTGGG - Intergenic
1125352150 15:38779244-38779266 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1125352612 15:38783226-38783248 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1126720104 15:51569316-51569338 GCTGCTGGGAAGTTTGAACTGGG + Intronic
1126888993 15:53183718-53183740 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1126952182 15:53893613-53893635 GCTGCCAGGAAGTTCAAACTGGG - Intergenic
1127031779 15:54872175-54872197 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1127158072 15:56150105-56150127 GCTGCTGGGAAGTTCAAACTGGG + Intronic
1127373747 15:58363277-58363299 GCCGCCAGGAAGTTTGAACTGGG + Intronic
1128883689 15:71265834-71265856 GCCGCCAGGAAGTTCAAACTCGG + Intronic
1128939040 15:71771955-71771977 GCAGATAGGAAGTGTGAGGTGGG + Intronic
1129507939 15:76098839-76098861 GCTGCTGGGAAGTTTGAACTGGG - Intronic
1129618503 15:77120720-77120742 GCCGCTAGGAAATTTAAATAAGG - Intronic
1130810930 15:87377708-87377730 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
1133831332 16:9326182-9326204 GCTGCTATGAAGATTAAAGAAGG - Intergenic
1134879585 16:17733635-17733657 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1135301749 16:21334688-21334710 GCGGCTGGGAAGTTTGAACTGGG - Intergenic
1135512087 16:23094335-23094357 GCAGCCAGGAAGCTCAAACTGGG + Intronic
1137638584 16:50008899-50008921 GCAGAGGGGAAGTGTAAAGTTGG + Intergenic
1138075972 16:54042571-54042593 GCAGCCAGGAAGCTTGAACTGGG + Intronic
1139105275 16:63820160-63820182 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1139375971 16:66496462-66496484 GCAGCCAGGAAGTTCGAACTGGG + Intronic
1140173103 16:72627752-72627774 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
1140303264 16:73778875-73778897 GCATCTGGGAAGTTGAAAGTAGG + Intergenic
1140993245 16:80234594-80234616 GCAGATAAGAACTTTAAAGGAGG + Intergenic
1141235143 16:82209408-82209430 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1141246097 16:82309176-82309198 GCCGCTGGGAAGTTTGAACTGGG - Intergenic
1143257599 17:5573310-5573332 GCAGCTGGGAAGCTTGAACTGGG + Intronic
1143325983 17:6098739-6098761 CCAGCTTTAAAGTTTAAAGTGGG + Intronic
1145731284 17:27188581-27188603 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
1148967399 17:51447349-51447371 GCCGCTAGAAAGTTTGAACTGGG + Intergenic
1149093850 17:52817156-52817178 GCAGCTGGGAAGTTCGAACTGGG - Intergenic
1149795372 17:59514208-59514230 GGATCTTGGCAGTTTAAAGTAGG + Intergenic
1149932039 17:60766852-60766874 GCAGCCAGGAAGCTCAAACTGGG - Intronic
1153402388 18:4695143-4695165 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1153441296 18:5122470-5122492 GCAGCTAGGAAGCATGAACTGGG + Intergenic
1154041442 18:10859944-10859966 GCAGCTAGGAAGTTTAAAGTGGG + Intronic
1154185842 18:12182113-12182135 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1155080542 18:22406205-22406227 GCTGCCAGGAAGTTTAAACTGGG + Intergenic
1155114241 18:22749007-22749029 GCCGCCAGGAAGTTCAAACTGGG + Intergenic
1155597980 18:27510487-27510509 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
1155828730 18:30483561-30483583 GCAGCTTGGAATCTTAATGTAGG + Intergenic
1156115968 18:33787358-33787380 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1156186649 18:34671069-34671091 GCAGCTGGGAAGCTTGAACTGGG - Intronic
1156308131 18:35897959-35897981 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1156730974 18:40193160-40193182 GCAGCTGGGAAGCTCAAACTGGG - Intergenic
1156843081 18:41632218-41632240 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
1156859401 18:41818526-41818548 ACAGCTAGAGAGTTTAAAGCAGG - Intergenic
1157626669 18:49056647-49056669 GCTACTAGGGAGTCTAAAGTGGG - Intronic
1159342534 18:67154867-67154889 GCAGCTGGCAAGTTCAAGGTTGG + Intergenic
1160285385 18:77537798-77537820 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1164307643 19:24018982-24019004 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
1164347660 19:27286061-27286083 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
1164879360 19:31718202-31718224 GCAGCTTGGCAGTTTAAAATTGG - Intergenic
1166446596 19:42863185-42863207 GCAGCCAGGAAGCTCAAACTGGG - Intronic
1168635498 19:57993172-57993194 GCAGCTCAGAAGTCTAAAATGGG - Intronic
1202674005 1_KI270710v1_random:23858-23880 GCAGCCAGGAAGTTCGAACTGGG - Intergenic
925077046 2:1025478-1025500 GGAGGTAGGAAGTCTAAAATGGG + Intronic
925327041 2:3031026-3031048 GCAGCTGGGAAGGTTGAACTGGG + Intergenic
925470745 2:4158287-4158309 GCAGCCAGGAAGTTCGAACTGGG + Intergenic
925729142 2:6904918-6904940 GCTGCTGGGAAGTTCAAACTGGG - Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
926943962 2:18167956-18167978 GCTGCCAGGAAGTTCAAACTTGG - Intronic
927117174 2:19916615-19916637 GCCGCTGGGAAGTTGAAACTGGG + Intronic
927366657 2:22304828-22304850 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
927426261 2:22984629-22984651 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
928251570 2:29685778-29685800 GCAGGTAAGAAGTCTAAAATGGG + Intronic
928522706 2:32106108-32106130 GCAGCTAGGAAGCTTGAACTGGG - Intronic
929025728 2:37599846-37599868 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
930778977 2:55204170-55204192 GCTACTAGGGAGTTTAAGGTAGG + Intronic
931469213 2:62521177-62521199 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
931698750 2:64891498-64891520 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
931840611 2:66144470-66144492 GCAGCTGGGAAGCTCAAACTGGG - Intergenic
931846237 2:66206796-66206818 GCAGCTGGGAAGCTCAAATTGGG + Intergenic
932094928 2:68839174-68839196 GCAGGAGGGAAGTTTAAAGCTGG - Intergenic
932935395 2:76096304-76096326 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
933241856 2:79930585-79930607 GCATCCAGGAAGTCTATAGTGGG - Intronic
933519081 2:83347952-83347974 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
934552415 2:95270542-95270564 GCCGCTAGGAGGTTTGAAGCAGG + Intergenic
935450258 2:103201031-103201053 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
935617771 2:105103363-105103385 ACAGCCATCAAGTTTAAAGTAGG + Intergenic
936448299 2:112614651-112614673 GCTGCTGGGAAGTTCAAACTGGG - Intergenic
936834257 2:116687994-116688016 GCATTTAGGGAGTTTAAATTTGG - Intergenic
937186762 2:120051302-120051324 GCTGCTAGGAAGCTTGAACTGGG - Intronic
937453011 2:122018205-122018227 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
937534786 2:122873027-122873049 GCATTTGAGAAGTTTAAAGTGGG - Intergenic
937573533 2:123392051-123392073 GCTGCCAGGAAGTTTGAACTGGG + Intergenic
937975492 2:127579950-127579972 AAAGCTAGGAAGTTAGAAGTCGG + Intronic
938718481 2:134043234-134043256 GCAGCCAGGAAGCTCAAAATGGG + Intergenic
939033287 2:137101766-137101788 GCTGCTGGGAAGTTCAAACTGGG + Intronic
939502657 2:143006520-143006542 GCAGCCAGGAAGCTCAAACTGGG + Intronic
939730850 2:145782851-145782873 GCAGCCTGGAAGTTTGAACTAGG + Intergenic
939795753 2:146642289-146642311 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
940055277 2:149506906-149506928 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
940080559 2:149796253-149796275 GCAGCCGGGAAGTTTGAACTGGG - Intergenic
940095177 2:149966213-149966235 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
940171769 2:150836269-150836291 GCTGCTAGGAAATATAAAGCAGG - Intergenic
940602617 2:155880585-155880607 GCCGCTGGGAAGTTCAAACTGGG + Intergenic
940808248 2:158212369-158212391 GCATTAAGGAAATTTAAAGTGGG - Intronic
940925189 2:159356366-159356388 GCTGCCAGGAAGTTCAAACTGGG + Intronic
940964542 2:159822415-159822437 GCTGCTGGGAAGTTTGAACTGGG + Intronic
940992816 2:160114989-160115011 GCAGCTGGGAAGCTCAAACTGGG + Intronic
940995853 2:160148937-160148959 GCAGCCAGGAAGCTCAAATTGGG + Intronic
941385503 2:164845429-164845451 GCAGATAGGCATGTTAAAGTGGG + Intergenic
941546159 2:166854181-166854203 GCAGCCAGGAAGTTCTAACTGGG + Intergenic
941602344 2:167558796-167558818 GCAGCCAGGAAGTTCGAACTGGG + Intergenic
942000988 2:171646919-171646941 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
942056926 2:172192922-172192944 GCAGCTGGGAAGCTCAAACTGGG - Intergenic
942742535 2:179196421-179196443 GCAGCCAGGAAGCTCAAACTGGG + Intronic
943180899 2:184540120-184540142 GCCACTTGGAAGTTTGAAGTGGG + Intergenic
943189420 2:184657195-184657217 GCTACTAGGAAGTCTGAAGTGGG - Intronic
943255749 2:185591409-185591431 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
943359614 2:186901769-186901791 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
944077082 2:195744352-195744374 GCAGCCAGGAAGCTTGAACTGGG + Intronic
944468232 2:200025183-200025205 GCACATAGGAAGTCTAAAGGGGG - Intergenic
944520984 2:200566717-200566739 GCGGCTAGGAAGCTTGAAGCCGG - Intronic
944607943 2:201369993-201370015 GCTGCTGGGAAGTTTGAACTGGG + Intergenic
944629859 2:201613044-201613066 GCAGCTGGGAAGCTCAAACTGGG + Intronic
945188210 2:207161053-207161075 GCAGTTTGGTATTTTAAAGTGGG - Intronic
945533754 2:210986959-210986981 GCTGCCAGGAAGTTCAAACTGGG - Intergenic
945945214 2:215988770-215988792 GCCGCTGGGAAGTTTGAACTGGG + Intronic
946002003 2:216490138-216490160 GTGGCTCGGAAGTTTAAAGAGGG + Intergenic
946205867 2:218108215-218108237 GCAGCTGGGAAGCTCAAACTGGG - Intergenic
948555890 2:238810736-238810758 GCAGCTAGGAAAATTAATATAGG - Intergenic
1169646247 20:7812923-7812945 GCTGCCAGGAAGTTTGAACTTGG - Intergenic
1170238335 20:14133235-14133257 CCAGCTAAGAACTTTAAGGTAGG - Intronic
1170250025 20:14270980-14271002 GCAGCCAGGAAGTTCTAACTGGG + Intronic
1170556269 20:17517582-17517604 ACTTCTAGAAAGTTTAAAGTTGG - Intronic
1170834372 20:19871035-19871057 TCAGCTAGGAATTTTTATGTTGG - Intergenic
1171050509 20:21853902-21853924 GCGGCCAGGAAGTTTGAACTGGG + Intergenic
1171056933 20:21916382-21916404 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
1171065410 20:22009906-22009928 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1171068785 20:22046114-22046136 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1171466350 20:25330428-25330450 GCAGCCAGGAAGCTCAAACTGGG + Intronic
1171819113 20:29817205-29817227 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
1175026245 20:55905899-55905921 GCAGCCGGGAAGTTTGAACTGGG - Intergenic
1175172536 20:57090584-57090606 GGAGCTCGGAAGTCTGAAGTGGG - Intergenic
1176635462 21:9188732-9188754 GCAGCCAGGAAGTTCGAACTGGG - Intergenic
1176637924 21:9266403-9266425 GCAGCCAGGAAGTTCGAACTGGG + Intergenic
1176878858 21:14167201-14167223 GCAGCTGGGAAGCTTGAACTGGG + Intronic
1177366885 21:20151282-20151304 GCAGTGAGGAAGATAAAAGTAGG + Intergenic
1178348100 21:31849463-31849485 ACTGATAGGAAGTTTAAAGAAGG + Intergenic
1179453419 21:41480943-41480965 GCAGCTAGGACGATACAAGTTGG - Intronic
1180371039 22:12037006-12037028 GCAGCCAGGAAGTTCGAACTGGG - Intergenic
1180377820 22:12111466-12111488 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
1180414647 22:12697733-12697755 GCAGCTGGGAAGTTCGAACTGGG + Intergenic
1180421964 22:12873900-12873922 GCAGCCAGGAAGTTCGAACTGGG + Intergenic
1181868910 22:25882284-25882306 GCTGCTAGGAAGTTCAGTGTTGG - Intronic
1182057785 22:27373514-27373536 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1182707974 22:32300182-32300204 GCAGCTGGGAAGCTCAAACTGGG - Intergenic
1182789833 22:32941942-32941964 GCAGCCAGGAAGCTCAAACTGGG + Intronic
1184886739 22:47351175-47351197 GCAGCTGGGAAGCTCAAACTGGG - Intergenic
949288029 3:2429730-2429752 GCAGCAAGGAAGCTCAAACTGGG - Intronic
949453329 3:4211811-4211833 GCAGCCAGGAAGTTCGAACTGGG + Intronic
949641024 3:6036151-6036173 GCAGCCAGGAAGTTTAAAGTGGG - Intergenic
951497782 3:23349722-23349744 GCAGCCAGGAAGCTCAAACTGGG + Intronic
951519472 3:23597984-23598006 GCAGGTAGGAAGTTTAACTCTGG - Intergenic
952680229 3:36083213-36083235 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
952909219 3:38167480-38167502 GCAGCTAGGAAGTCTTCAGTTGG - Intronic
953023289 3:39129683-39129705 GCATCTAAGCAATTTAAAGTGGG + Intronic
953274902 3:41485259-41485281 TCATCTAGCAAGTTTAAAGTGGG + Intronic
953289498 3:41647848-41647870 GCAGCTGGGAAGCTCAAACTGGG - Intronic
954507659 3:51092393-51092415 GCCGCTGGGAAGTTTGAACTGGG + Intronic
955423544 3:58764183-58764205 GCAGCTGGGAAGCTCAAACTGGG - Intronic
955504152 3:59614325-59614347 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
956243426 3:67154649-67154671 GCCGCCAGGAAGTTTGAACTGGG + Intergenic
956373231 3:68586798-68586820 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
956941136 3:74162612-74162634 GCGGCTGGGAAGTTCAAACTTGG - Intergenic
957061892 3:75489111-75489133 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
957130213 3:76214656-76214678 GCAGCCAGGAAGCTTGAACTGGG + Intronic
957565432 3:81878604-81878626 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
957811576 3:85229072-85229094 GCTGCCAGGAAGTTCAAACTGGG - Intronic
958185146 3:90110638-90110660 GCAGCCAGGAAGCTTGAAATGGG - Intergenic
958257445 3:91341152-91341174 GCTGCTGGGAAGTTTGAACTGGG - Intergenic
958618500 3:96527125-96527147 GCAGCTGGGAAGATCAAACTGGG + Intergenic
958694551 3:97510952-97510974 GCTGCTGGGAAGTGTAAACTGGG - Intronic
958769256 3:98407053-98407075 GCAGCTGAGAAGTTTGAACTGGG + Intergenic
959266733 3:104149996-104150018 GCAGATAGGAAGCTCACAGTGGG + Intergenic
959291905 3:104485325-104485347 GCTGCTGGGAAGTTCAAACTGGG + Intergenic
959464221 3:106665772-106665794 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
959736490 3:109665199-109665221 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
959940137 3:112072625-112072647 GCAGCCAGGAAGCTCAAACTGGG - Intronic
960000302 3:112724595-112724617 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
960078681 3:113516729-113516751 GCACTTAGTAAGTGTAAAGTAGG - Intergenic
960763298 3:121097093-121097115 GCAGCCAGGAAGTTTGAACTGGG - Intronic
961303439 3:125937115-125937137 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
961977535 3:131042488-131042510 GCTGCCAGGAAGTTCAAACTGGG + Intronic
961998232 3:131269031-131269053 GCTGCTGGGAAGTTTGAACTGGG - Intronic
962238395 3:133729310-133729332 GCAGCTGGGAAGCTCAAACTGGG - Intergenic
962554075 3:136528230-136528252 GCAGCCAGGAAGTTCAAATTGGG - Intronic
962675198 3:137751160-137751182 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
963013947 3:140803049-140803071 GCTGCTGGGAAGTTTGAACTGGG - Intergenic
963620465 3:147599489-147599511 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
963976335 3:151484176-151484198 GCCGCTTGGAAGTTTGAACTGGG + Intergenic
964053115 3:152419982-152420004 GCTGCCAGGAAGTTTGAACTGGG + Intronic
964264175 3:154875358-154875380 GCTGCCAGGAAGTTTGAACTGGG + Intergenic
964318548 3:155469540-155469562 GCAGCCAGGAAGCTCAAACTGGG + Intronic
964564482 3:158034623-158034645 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
964688457 3:159423546-159423568 GCAGCTGGGAAGCTCAAACTGGG + Intronic
964995026 3:162868264-162868286 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
965194149 3:165572808-165572830 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
965311094 3:167129832-167129854 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
965324778 3:167289962-167289984 GCTGCTGGGAAGTTCAAACTGGG + Intronic
965393059 3:168128745-168128767 GCGGCTGGGAAGTTCAAACTGGG + Intergenic
965623891 3:170668028-170668050 GCAGCTGGGAAGCTCAAACTGGG - Intronic
965717737 3:171625342-171625364 GCAGCCAGGAAGCTTGAACTGGG + Intronic
965779850 3:172273613-172273635 GCTGCTAGGAAGGTCAAATTAGG + Intronic
966493740 3:180556668-180556690 GCCGCTGGGAAGTTGAAACTGGG + Intergenic
1202748971 3_GL000221v1_random:138618-138640 GCAGCCAGGAAGTTCGAACTGGG - Intergenic
970022290 4:11583036-11583058 GCAGCTGGGAAGCTCAAACTGGG - Intergenic
970259825 4:14212745-14212767 GCAGCTGGGAAGGTTGAACTGGG - Intergenic
970611518 4:17729241-17729263 GCAGCTGGGAAGCTCAAACTGGG + Intronic
970685263 4:18559794-18559816 GCTGCTGGGAAGTTCAAACTGGG + Intergenic
970862672 4:20721972-20721994 GCAGCTGGGAAGCTCAAACTGGG - Intronic
970864110 4:20739077-20739099 GCAGCCAGGAAGCTCAAACTAGG + Intronic
970975716 4:22040842-22040864 GCGGCCAGGAAGTTTGAACTGGG - Intergenic
970985007 4:22146900-22146922 GCAGCTGGGAAGCTCAAACTTGG + Intergenic
971649870 4:29257757-29257779 GCTACTAGGAAGGTTGAAGTGGG - Intergenic
972373454 4:38448439-38448461 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
972416712 4:38847777-38847799 GCAGCCAGGAAGCTCAAACTGGG + Intronic
972517616 4:39822720-39822742 CCAGCCAGGAAGTTTGAAGGTGG + Intergenic
972743257 4:41909272-41909294 GCTGCTGGGAAGTTTGAACTGGG - Intergenic
972946659 4:44264879-44264901 GCAGCTGGGAAGCTTGAACTGGG + Intronic
973124553 4:46567592-46567614 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
973556795 4:52091967-52091989 GCTGCTAGGAAGTTCAAATTGGG - Intronic
973564527 4:52170843-52170865 GCAGCCAGGAAGATTGAATTGGG - Intergenic
973732265 4:53833812-53833834 GCAGCCAGGAAGCTTGAACTGGG + Intronic
973986924 4:56363217-56363239 GCAGCCAGGAAGCTCAAACTGGG + Intronic
974280037 4:59780514-59780536 GCAGCCAGGAAGTTTGAACTGGG + Intergenic
974307080 4:60156122-60156144 GCTGCCAGGAAGTTCAAATTGGG - Intergenic
974326285 4:60419124-60419146 GCTGCTGGGAAGTTTGAACTAGG - Intergenic
974347087 4:60696317-60696339 GCAGCTGGGAAGCTCAAATTGGG + Intergenic
974418954 4:61646804-61646826 GCAGCTGGGAAGCTCAAACTGGG - Intronic
974431923 4:61809570-61809592 GCAGCTAGCAATTTTAAATAGGG - Intronic
974944050 4:68505029-68505051 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
975136688 4:70881738-70881760 GCAGATAAGAATTTAAAAGTTGG - Intergenic
975227533 4:71891785-71891807 GAAGCTAGGAAGTTTGGACTGGG + Intergenic
975364946 4:73518490-73518512 GCAGTCAGGAAGTTCAAACTGGG - Intergenic
975524268 4:75331677-75331699 GCCACTAGGAAGTTTGAACTGGG + Intergenic
975727149 4:77303244-77303266 GCTGCTAGGAAGCTCAAACTGGG - Intronic
975753573 4:77549996-77550018 GCAGCTAGGAAGCTTGAACTGGG - Intronic
975860037 4:78667406-78667428 GCAGCTAGAAAGTATTAAGTGGG - Intergenic
976063167 4:81154234-81154256 GCAGCCAGGAAGCTCAAACTGGG + Intronic
976158741 4:82175881-82175903 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
976167623 4:82272151-82272173 GCTGCTGGGAAGTTCAAACTGGG + Intergenic
976760098 4:88539409-88539431 GCAGCCAGGAAGCTTGAACTGGG + Intronic
976861523 4:89671805-89671827 GCTGCTAGGAAGTTCGAACTGGG + Intergenic
976941336 4:90705620-90705642 GCAGCCAGGAAGCTCAAACTGGG - Intronic
977288631 4:95139562-95139584 GCAGCCAGGAAGCTCAAACTGGG - Intronic
977333261 4:95664180-95664202 GCAGCTGGGAAGTTCGAACTGGG + Intergenic
977477996 4:97537538-97537560 GCAGCTGGGAAGTTCAAACTGGG + Intronic
977678204 4:99770969-99770991 GCAGCTGGGAAGCTCAAACTGGG - Intergenic
978108286 4:104930936-104930958 GCGGCCAGGAAGTTTGAACTGGG + Intergenic
978205295 4:106073769-106073791 GCAGCCAGGAAGCTCAAACTGGG - Intronic
978209662 4:106120430-106120452 GCAGCTGGGAAGCTTGAACTGGG + Intronic
978313295 4:107409667-107409689 GCTGCCAGGAAGTTTATACTGGG + Intergenic
978469575 4:109048753-109048775 GTAGCTAGGAAGTTGGAAATTGG + Intronic
978632502 4:110763134-110763156 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
979022855 4:115525048-115525070 GCCGCTGGGAAGTTTGAACTTGG - Intergenic
979236307 4:118404172-118404194 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
979757637 4:124361703-124361725 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
980100300 4:128535627-128535649 GCAGCCAGGAAGTTGGAACTGGG - Intergenic
980217968 4:129876387-129876409 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
980278944 4:130693026-130693048 GAAGCCAGGATGTTTAAAGAGGG - Intergenic
981441818 4:144792074-144792096 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
981869425 4:149468470-149468492 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
982145404 4:152383612-152383634 AAAGCTTGGAAGTTAAAAGTTGG - Intronic
982154870 4:152508677-152508699 ACAGCAAGGAAGTTAAAAATTGG + Intronic
982426453 4:155267819-155267841 GCAACTAGGAGTTTGAAAGTTGG + Intergenic
982619951 4:157691976-157691998 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
982675276 4:158368202-158368224 GCAGCCAGGAAGTTCGAAGTGGG - Intronic
982691245 4:158550099-158550121 GCAGCTGGGAAGCTTGAACTGGG - Intronic
982883296 4:160746827-160746849 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
982909205 4:161118011-161118033 GCCTCCAGGAAGTTTAAACTTGG - Intergenic
983334510 4:166374925-166374947 GCAGCTGGGAAGTTTGAACTGGG - Intergenic
983385447 4:167055790-167055812 GCAGCCAGGAAGCTTGAACTGGG + Intronic
984063467 4:175020217-175020239 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
984493696 4:180468802-180468824 GCCGCTGGGAAGTTTGAACTGGG + Intergenic
1202752824 4_GL000008v2_random:24820-24842 GCAGCCAGGAAGTTCGAAATTGG + Intergenic
986920504 5:12674031-12674053 GCAACTGGGAAGTTTGAACTTGG - Intergenic
987307212 5:16648833-16648855 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
987678639 5:21107889-21107911 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
987838028 5:23186596-23186618 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
987980953 5:25083186-25083208 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
987982418 5:25103380-25103402 GCAGCAAGGAAGTTTATTGGTGG - Intergenic
988511355 5:31867335-31867357 GCTGCTCTGAAGTTTAAAGGTGG - Intronic
988671769 5:33389146-33389168 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
988917753 5:35912204-35912226 GCAGCCAGGAAGCTCAAACTGGG + Intronic
989087291 5:37689174-37689196 GCAGCTAGGAAGCTTGAACTGGG + Intronic
989194184 5:38700011-38700033 GCTGCTGGGAAGTTCAAACTGGG + Intergenic
989449496 5:41570187-41570209 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
989608200 5:43266268-43266290 GCAGCTGGGAAGCTCAAACTGGG - Intronic
989614727 5:43328529-43328551 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
989849695 5:46193891-46193913 GCAGCTGGGAAGCTCAAAATGGG + Intergenic
989949495 5:50280696-50280718 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
989968183 5:50489638-50489660 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
989977286 5:50601780-50601802 GCGGCCAGGAAGTTCAAACTGGG - Intergenic
990197452 5:53334587-53334609 GCACCTTGCAAGTTTAAACTGGG - Intergenic
990224271 5:53631639-53631661 GCTGCTGGGAAGTTCAAACTGGG - Intronic
990496945 5:56357969-56357991 GCATGAAAGAAGTTTAAAGTAGG + Intergenic
990803522 5:59632119-59632141 GCTGCCAGGAAGTTCAAACTGGG + Intronic
990838591 5:60049893-60049915 GCAGCCAGGAAGCTCAAACTGGG - Intronic
990842942 5:60104349-60104371 GCAGCCAGGAAGCTCAAACTGGG + Intronic
991128147 5:63090682-63090704 GCTGCTGGGAAGTTCAAACTGGG + Intergenic
991213527 5:64134625-64134647 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
991236725 5:64407352-64407374 GCCACTAGGAAGTTCAAACTGGG + Intergenic
991341014 5:65609224-65609246 GCAGGTAGGTAGTTTAAATGTGG - Exonic
992650357 5:78853711-78853733 GCAGCCAGGAAGCTCAAACTTGG - Intronic
993142380 5:84050807-84050829 GCAGCCAGGAAGCTTGAACTGGG + Intronic
993381838 5:87217631-87217653 GCTGCTGGGAAGTTTGAACTGGG - Intergenic
993410461 5:87567289-87567311 GCCACTGGGAAGTTCAAAGTAGG - Intergenic
993497408 5:88623124-88623146 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
993676512 5:90821943-90821965 GCAGCCAGGAAGCTCAAACTGGG - Intronic
994224816 5:97239926-97239948 GCAGCTGGGAAGCTCAAACTGGG - Intergenic
994233519 5:97336153-97336175 GCTGCTAGGAAGTTTGAACTGGG - Intergenic
994545658 5:101163317-101163339 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
994780232 5:104079885-104079907 GCAGCCAGGAAGCTCGAAGTGGG - Intergenic
994806310 5:104451907-104451929 GCAGCCAGGAAGCTCGAAGTGGG - Intergenic
994954637 5:106511896-106511918 ACAGTTAAGAAGTTTAAAGTGGG + Intergenic
996158510 5:120132528-120132550 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
996231077 5:121064716-121064738 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
996331266 5:122331648-122331670 GCAGCTACGAACTAGAAAGTGGG - Intronic
996520806 5:124423612-124423634 GCAGCCAGGAAGCTAAAAGTGGG + Intergenic
996651505 5:125882581-125882603 GCAGATAGGAAATATTAAGTTGG + Intergenic
997481824 5:134191278-134191300 GAAGCCAGGATTTTTAAAGTAGG - Intronic
997931366 5:138074768-138074790 GCAACTTGGGAGGTTAAAGTGGG + Intergenic
998098020 5:139408402-139408424 GCTACTAGGAAGGTTAAGGTGGG - Intergenic
998241730 5:140452214-140452236 GCGGCTAGGAAGCTCAAACTGGG + Intronic
999064754 5:148673843-148673865 GCAGCCAGGAAGCTTGAACTGGG - Intronic
999489820 5:152039057-152039079 GCAGCCAGGAAGTTTGAACTGGG - Intergenic
999605133 5:153306087-153306109 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
1000482282 5:161793434-161793456 GCAGTTAGGACTTTCAAAGTAGG - Intergenic
1001107581 5:168868400-168868422 GCTGCTAGGGAGACTAAAGTGGG - Intronic
1001212187 5:169820114-169820136 GCAGCCAGGAAGCTCAAACTGGG + Intronic
1002010158 5:176272928-176272950 GCAGCCAGGAAGCTCAAACTGGG + Intronic
1002216568 5:177639188-177639210 GCAGCCAGGAAGCTCAAACTAGG - Intergenic
1002362459 5:178683445-178683467 GCAGATAAGAATTTTTAAGTAGG - Intergenic
1005303625 6:24494140-24494162 GCCACTAGTAAGATTAAAGTTGG - Intronic
1006010682 6:31040510-31040532 GGAGATCGGAAGTTTAAAATAGG - Intergenic
1006198363 6:32263054-32263076 GCTGCTGGGAAGTTCAAACTGGG - Intergenic
1007435020 6:41804517-41804539 GCACCTGGGAAGGTTATAGTGGG - Intronic
1007988360 6:46230423-46230445 GCAGCCAGGAAGCTCAAACTGGG - Intronic
1008412220 6:51193317-51193339 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
1008717971 6:54312168-54312190 GCTACTTGGAAGTTTAAAGTGGG - Intronic
1009186349 6:60579209-60579231 GCTGCTGGGAAGTTTGAACTGGG + Intergenic
1009230254 6:61053057-61053079 GCAGCCAGGAAGTTCCAACTGGG - Intergenic
1009322771 6:62312511-62312533 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1009326297 6:62352405-62352427 GAAGCTAGGCAGTTAGAAGTAGG - Intergenic
1009410588 6:63361303-63361325 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
1009453627 6:63829556-63829578 GCAGCTGGGAAGCTCAAACTGGG + Intronic
1009457932 6:63878624-63878646 GCAGCCAGGAAGCTCGAAGTGGG - Intronic
1009476416 6:64097400-64097422 GCAGCCAGGAAGCTCAAACTGGG - Intronic
1009613027 6:65971478-65971500 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1009880527 6:69560846-69560868 GCTGCCAGGAAGTTCAAACTGGG + Intergenic
1009917166 6:70010824-70010846 GCAGCCAGGAAGCTCAAACTGGG + Intronic
1010006244 6:70998396-70998418 GCAGCCAGGAAATTTGAACTGGG + Intergenic
1010137318 6:72570615-72570637 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1010307637 6:74343434-74343456 GCAGCCAGGAAGCTCAAACTTGG - Intergenic
1010364261 6:75031313-75031335 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1010526443 6:76905729-76905751 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
1010553522 6:77252000-77252022 GCAGCCAGGAAGCTTGAAATGGG + Intergenic
1010589889 6:77700242-77700264 GCAGCTGGGAAGCTCAAACTGGG - Intronic
1010679622 6:78783607-78783629 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
1010721253 6:79285152-79285174 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1011760739 6:90562567-90562589 GCAGCCAGGAAGTTCGAACTGGG + Intronic
1012083054 6:94785203-94785225 GCAACCAGGAAGTTCAAACTGGG - Intergenic
1012207455 6:96478668-96478690 GCTGCTGGGAAGTTAAAACTGGG - Intergenic
1012209269 6:96499960-96499982 GCTGCCAGGAAGTTCAAACTGGG - Intergenic
1012289042 6:97428217-97428239 GCAGTTAGGTAATTTAGAGTCGG + Intergenic
1012654120 6:101793862-101793884 GCAGCCAGGAAGCTTGAACTGGG - Intronic
1012722099 6:102758409-102758431 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
1012799062 6:103802313-103802335 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
1012941023 6:105415471-105415493 GCAGCAAGGAAGCTTGAACTGGG + Intergenic
1013038008 6:106405260-106405282 GCTGCTGGGAAGTTCAAACTAGG + Intergenic
1014466343 6:121760869-121760891 GCTGCTGGGAAGTTTGAACTGGG + Intergenic
1014565651 6:122945049-122945071 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
1014674582 6:124348486-124348508 GCAGCCAGGAAGCTCAAACTGGG - Intronic
1014881237 6:126726741-126726763 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1015802092 6:137070510-137070532 GCTGCCAGGAAGTTTGAACTGGG + Intergenic
1015958770 6:138625751-138625773 GCAGCTAGGAAGACTGAGGTGGG - Intronic
1015967687 6:138711576-138711598 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1016365134 6:143307858-143307880 GCAGCTGGGAAGCTTGAACTGGG - Intronic
1016440909 6:144082437-144082459 GCAGATAGGAATTTTTAAGATGG - Intergenic
1017322643 6:153111317-153111339 GCCGCCAGGAAGTTCAAACTGGG + Intronic
1017653559 6:156605177-156605199 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1018114616 6:160571638-160571660 ACCGCTAGGAAGTTTGAACTGGG - Intronic
1018525747 6:164708404-164708426 GCAGCTGTGAAGTTCAAACTGGG - Intergenic
1019678756 7:2332505-2332527 GCACCTAGGAAGGTCGAAGTAGG + Intronic
1020267571 7:6571515-6571537 GCAGCTTGGAGGTTAGAAGTAGG + Intergenic
1020358261 7:7301074-7301096 GCCACCAGGAAGTTCAAAGTGGG - Intergenic
1020428656 7:8096610-8096632 GCTGCTGGGAAGTTCAAACTGGG + Intergenic
1020479201 7:8636983-8637005 GAAGCTAGGCTGCTTAAAGTAGG - Intronic
1020694055 7:11392759-11392781 GCTGCTGGGAAGTTTGAACTGGG + Intronic
1020716070 7:11675641-11675663 GCAGCCAGGAAGTTCACACTGGG + Intronic
1020874253 7:13673783-13673805 GCTGCCAGGAAGTTTGAACTGGG - Intergenic
1021282678 7:18739923-18739945 GCAGCTGGGAAGCTCAAACTGGG - Intronic
1021347656 7:19548001-19548023 GCCACTGGGAAGTTTAAACTGGG - Intergenic
1021388929 7:20068279-20068301 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
1022079731 7:27008095-27008117 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1022240764 7:28510524-28510546 GCAGCTAGAAGTTTTAAAGGTGG - Intronic
1022619110 7:31964450-31964472 GCAGCTGGGAAGCTCAAACTGGG + Intronic
1022683652 7:32574282-32574304 GCACATAGGAGTTTTAAAGTAGG + Intronic
1024552640 7:50576481-50576503 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1024592357 7:50899320-50899342 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1024664889 7:51536527-51536549 GCTGCTGGGAAGTTTGAACTAGG - Intergenic
1024667034 7:51557814-51557836 GCAGCTAGGAAGCTTGAACTGGG - Intergenic
1024738222 7:52328464-52328486 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1027276913 7:76566857-76566879 GCAGCTGGGAAGCTCAAACTGGG - Intergenic
1027957444 7:84899131-84899153 GCACTTTGGGAGTTTAAAGTGGG + Intergenic
1027982992 7:85250334-85250356 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1028013576 7:85679492-85679514 GCAGCCAGGAAGCTTGAATTGGG - Intergenic
1028446419 7:90928870-90928892 GCAGCCAGGAAGCTCAAACTGGG - Intronic
1028489459 7:91395008-91395030 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
1028523650 7:91759461-91759483 GCAACCAGGAAGTTTGAACTGGG + Intronic
1028652829 7:93170174-93170196 GCTGCTGGGAAGTTCAAACTGGG - Intergenic
1028905713 7:96152038-96152060 GCAGCTAGGAAGGTGAACCTTGG + Intronic
1029313166 7:99686499-99686521 GCAGCTGGGAAGCTCAAACTGGG + Intronic
1029324737 7:99796477-99796499 GCTGCTGGGAAGTTTGAACTGGG - Intergenic
1029916010 7:104210208-104210230 GCAGCCAGGAAGCTAAAACTAGG + Intergenic
1030449692 7:109692786-109692808 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
1030936767 7:115594279-115594301 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1031724749 7:125223806-125223828 GCAGTTTGGAAGTTCAAAATGGG - Intergenic
1033293444 7:140108918-140108940 GCAGCCAGGAAGCTCAAACTGGG - Intronic
1033623847 7:143088764-143088786 GCTGCCAGGAAGTTTGAACTGGG + Intergenic
1034583323 7:152066085-152066107 GCAGCCAGGAAGCTCAAACTGGG - Intronic
1035189065 7:157149808-157149830 GCACCTAGGAATTTGGAAGTGGG + Intronic
1035998300 8:4573886-4573908 GCTGCCAGGAAGTTTGAACTGGG - Intronic
1036117392 8:5972835-5972857 GCAGCTGAGAAGTTTTAAGATGG - Intergenic
1036558022 8:9876965-9876987 GCTGCCAGGAAGTTCAAACTGGG + Intergenic
1036804480 8:11820504-11820526 GCAGCAAGGAAGCTTGAACTGGG - Intronic
1037082460 8:14803693-14803715 GCAGCCAGGAAGCTCAAACTGGG + Intronic
1037853992 8:22356566-22356588 GCAGCTAGGAAAGTTCAAGTTGG + Exonic
1038226201 8:25660451-25660473 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
1038567111 8:28628913-28628935 GCAACCAGGAAGATTAAAATGGG + Intronic
1039154577 8:34540713-34540735 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1039317952 8:36394109-36394131 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
1039470670 8:37811800-37811822 GCTACTAGGAAATTTAAAATGGG + Intronic
1040061944 8:43111415-43111437 GCAGCTGGGAAGCTCAAACTGGG + Intronic
1040083444 8:43312810-43312832 GCAGCCAGGAAGCTTGAACTCGG - Intergenic
1040403415 8:47075992-47076014 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1040756611 8:50783349-50783371 GCAGCCAGGAAGCTCAAACTGGG - Intronic
1041161570 8:55050326-55050348 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
1041294254 8:56338407-56338429 GCGGCCAGGAAGTTTGAACTGGG - Intergenic
1041423574 8:57695549-57695571 GCTGCTGGGAAGTTCAAACTGGG + Intergenic
1041581289 8:59462479-59462501 GCAGCCAGGAAGCTCAAAATGGG - Intergenic
1041634737 8:60130318-60130340 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1041637558 8:60160842-60160864 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1042042616 8:64609066-64609088 CAATCTAGGAAGTTCAAAGTTGG + Intronic
1042386507 8:68181495-68181517 GCACTTTGGAAGTTTAAAATAGG + Intronic
1042457225 8:69019482-69019504 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1042860833 8:73311916-73311938 GCAACTAGAATATTTAAAGTTGG + Intronic
1043787865 8:84425077-84425099 GCAGCTAGGAAGCTCGAACTGGG - Intronic
1044060082 8:87625284-87625306 GCAGCTGGGAAGCTCGAAGTGGG + Intergenic
1044183006 8:89218661-89218683 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1045088221 8:98710635-98710657 GCAGCCAGGAAGCTCAAACTGGG + Intronic
1045450271 8:102317427-102317449 GCAGCCAGGAAGCTTGAACTGGG + Intronic
1045618913 8:103951979-103952001 GCGGCCAGGAAGTTTGAACTGGG + Intronic
1046295880 8:112218502-112218524 GCTGCCAGGAAGTTCAGAGTGGG + Intergenic
1047118329 8:121870527-121870549 GCAGCTATGAAGCAGAAAGTGGG - Intergenic
1048914100 8:139165437-139165459 GCAGGCAGGAAGTTTGAACTGGG - Intergenic
1050034843 9:1424392-1424414 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
1050178979 9:2899730-2899752 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
1050369015 9:4901848-4901870 GCTGCCAGGAAGTTCAAACTGGG - Intergenic
1050381176 9:5032242-5032264 GCAGCCAGGAAGCTCAAACTGGG + Intronic
1050637424 9:7626881-7626903 GCTGCCAGGAAGTTCAAACTGGG + Intergenic
1051299043 9:15628517-15628539 GCAGCTGGGAAGCTTGAATTGGG + Intronic
1051913122 9:22177505-22177527 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1051941294 9:22508516-22508538 GTAGCCAGGAAGCTTGAAGTGGG - Intergenic
1052096569 9:24391243-24391265 GCCACTAGGAAGTTTGAACTGGG - Intergenic
1052336373 9:27324376-27324398 GCAGCTGAGAAGTTTGAACTGGG - Intergenic
1052382323 9:27784969-27784991 GCCTCTAGGAAGTTCAAACTGGG - Intergenic
1052496532 9:29232931-29232953 GCAGTTAGGAAGAAAAAAGTTGG + Intergenic
1052770515 9:32684600-32684622 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
1052814035 9:33085908-33085930 GCAGCTGGGAAGTTCGAACTGGG + Intergenic
1053608148 9:39681152-39681174 GCTGCCAGGAAGTTTGAACTGGG - Intergenic
1053718013 9:40916263-40916285 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1053827096 9:42036540-42036562 GCAGCCAGGAAGCTCAAACTGGG + Intronic
1053865989 9:42437512-42437534 GCTGCCAGGAAGTTTGAACTGGG - Intergenic
1054245383 9:62661257-62661279 GCTGCCAGGAAGTTTGAACTGGG + Intergenic
1054559512 9:66695788-66695810 GCTGCCAGGAAGTTTGAACTGGG + Intergenic
1054603467 9:67150892-67150914 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
1054719864 9:68593910-68593932 GCTGCCAGGAAGTTCAAACTGGG - Intergenic
1054997368 9:71407566-71407588 GCAGCCAGGAAGCTCAAAATGGG + Intronic
1055338675 9:75259331-75259353 GCAGCCAGGAAGATTAAACTGGG - Intergenic
1056000995 9:82216269-82216291 GCTGCCAGGAAGTTCAAACTGGG + Intergenic
1057022665 9:91712321-91712343 GCAGGAAAGCAGTTTAAAGTGGG - Intronic
1057163134 9:92905572-92905594 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
1057322339 9:94025995-94026017 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1057407950 9:94790458-94790480 GTAGCTAAGAAGTTGAAGGTAGG - Intronic
1057682778 9:97205629-97205651 GCAGCTGGGAAGTTGGAACTGGG + Intergenic
1058072856 9:100619376-100619398 GCCACTAGGAAGTTCAAACTGGG - Intergenic
1058081939 9:100710088-100710110 GCAGCTGGGAAGCTTGAATTGGG - Intergenic
1058095607 9:100856924-100856946 GGAGGTCAGAAGTTTAAAGTGGG + Intergenic
1058962541 9:110005673-110005695 GCAGCCAGGAAGCTTGAACTGGG - Intronic
1059005117 9:110393851-110393873 GCAGCCAGGAAGCTTGAACTGGG + Intronic
1059764996 9:117375770-117375792 GCAGGTCGGAAGTCCAAAGTGGG + Intronic
1062297623 9:135841226-135841248 GCCGCCAGGAAGTTTAAACTGGG + Intronic
1203758239 Un_GL000218v1:156036-156058 GCAGCCAGGAAGTTCGAACTGGG - Intergenic
1203370775 Un_KI270442v1:302472-302494 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1203717611 Un_KI270742v1:168708-168730 GCAGCCAGGAAGTTCGAACTGGG - Intergenic
1203533616 Un_KI270743v1:9525-9547 GCAGCCAGGAAGTTCGAACTGGG + Intergenic
1203540209 Un_KI270743v1:81822-81844 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
1203651825 Un_KI270751v1:132299-132321 GCAGCCAGGAAGTTCGAACTGGG - Intergenic
1185911165 X:3982398-3982420 GCTGCCAGGAAGTTCAAACTGGG + Intergenic
1188046883 X:25435673-25435695 ACAGCTAGAAAGTGGAAAGTGGG - Intergenic
1188130002 X:26419528-26419550 GCCGCTGGGAAGTTCAAACTGGG - Intergenic
1188658629 X:32731376-32731398 GCAGCTGGGAAGCTTGAACTGGG + Intronic
1188940818 X:36235270-36235292 GCAGCTGGGAAGCTTGAACTGGG - Intronic
1189970688 X:46415538-46415560 GCAGCCAGGAAGCTCGAAGTTGG - Intergenic
1190061895 X:47217078-47217100 GCAGGTAGGAATTTTTAAATCGG + Intergenic
1190606704 X:52150781-52150803 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
1190607547 X:52160400-52160422 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1190975562 X:55396994-55397016 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1191005095 X:55702800-55702822 GCTGCTGGGAAGTTCAAATTGGG + Intergenic
1191015403 X:55804669-55804691 GCATCTAGAAAGTGTAAAGTTGG - Intergenic
1191064221 X:56330647-56330669 GCAGCCAGGAAGGTCAAACTGGG - Intergenic
1191092338 X:56636488-56636510 GCAGCTGGGAAGATCAAACTGGG + Intergenic
1191153269 X:57243129-57243151 GCTGCCAGGAAGTTCAAACTGGG + Intergenic
1191192794 X:57684747-57684769 GCAGCCAGGAAGCTTGAAATGGG + Intergenic
1191204059 X:57816096-57816118 GCAGCTGGGAAGCTCAAACTGGG - Intergenic
1191610185 X:63103378-63103400 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
1191625534 X:63266722-63266744 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
1191628212 X:63291579-63291601 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
1191645680 X:63478481-63478503 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
1191698895 X:64018787-64018809 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1191704918 X:64084506-64084528 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1191705137 X:64086064-64086086 GCTGCTGGGAAGTTCAAACTGGG + Intergenic
1191765634 X:64695488-64695510 GCAGCCAGGAAGCTCGAAGTGGG - Intergenic
1191947768 X:66554169-66554191 GCTGCCAGGAAGTTTGAAATTGG + Intergenic
1192136183 X:68602739-68602761 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1192522960 X:71817149-71817171 GCAGCTGGGAAGTTCGAACTGGG + Intergenic
1192685933 X:73305230-73305252 GCAGCCAGGAAGCTCAAACTGGG - Intergenic
1192694750 X:73401746-73401768 GCCGCTGGGAAGTTTAAACTGGG + Intergenic
1192825935 X:74696171-74696193 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1192843157 X:74878516-74878538 GCAGCCAGGAAGCTTGAACTGGG - Intronic
1192974424 X:76267883-76267905 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1193002967 X:76583483-76583505 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
1193004699 X:76602740-76602762 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1193033526 X:76924838-76924860 GCAGCCAGGAAGCTTAAACTGGG + Intergenic
1193038473 X:76979084-76979106 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
1193060142 X:77197221-77197243 GCTGCTGGGAAGTTCAAACTTGG - Intergenic
1193157463 X:78189329-78189351 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1193387943 X:80893268-80893290 GCAGCTAGGAAGCTCAAACTGGG - Intergenic
1193640989 X:84009286-84009308 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1194139874 X:90196336-90196358 GCTGCCAGGAAGTTTGAATTGGG + Intergenic
1194255353 X:91627576-91627598 GCAGCTGGGAAGTTCCAACTGGG + Intergenic
1195098040 X:101524785-101524807 GCAGCCAGGAAGCTTGAACTGGG + Intronic
1195102319 X:101567238-101567260 GCCGCCAGGAAGTTCAAACTTGG + Intergenic
1195351163 X:103998138-103998160 GCCGCCAGGAAGTTTGAACTGGG - Intergenic
1195483959 X:105381219-105381241 ACAGCTAGGAATATTAAATTTGG + Intronic
1195723562 X:107890765-107890787 GCAGCTGGGAAGCTTGAACTGGG - Intronic
1196167450 X:112551414-112551436 GCAGCTGGGAAGCTCAAACTGGG - Intergenic
1196203483 X:112912642-112912664 ACAGGTAGGAAGTGTGAAGTTGG + Intergenic
1196473223 X:116052428-116052450 GCAGCTGGGAAGTTCGAACTGGG - Intergenic
1196481910 X:116159676-116159698 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
1196545708 X:116962340-116962362 GCAGCCAGGAAGTTCAAACTGGG - Intergenic
1196946575 X:120832825-120832847 GCCGCTGGGAAGTTCAAACTGGG - Intergenic
1197051209 X:122061411-122061433 GCTGCCAGGAAGTTTGAACTGGG + Intergenic
1197510366 X:127362700-127362722 GCAGCCGGGAAGCTTAAACTGGG + Intergenic
1197667714 X:129241335-129241357 GCAGCCAGGAAGCTTGAACTAGG + Intergenic
1197984118 X:132249674-132249696 GCAGCTGGGAAGTTCTAACTGGG - Intergenic
1198165318 X:134049808-134049830 GCAGCTGGGAAGCTCAAACTGGG - Intergenic
1198172161 X:134117659-134117681 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1198663493 X:138996563-138996585 GCTGCTGGGAAGTTCAAACTGGG + Intronic
1199024685 X:142922243-142922265 GCTGCTAGAAAATATAAAGTAGG + Intergenic
1199383793 X:147200761-147200783 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1199469801 X:148181805-148181827 GCTGCCAGGAAGTTCAAAATGGG - Intergenic
1199762619 X:150916674-150916696 CCAGCCAGGCTGTTTAAAGTTGG + Intergenic
1200485622 Y:3765305-3765327 GCTGCCAGGAAGTTTGAATTGGG + Intergenic
1200689674 Y:6294406-6294428 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1200732569 Y:6758398-6758420 GCAGCCAGGAAGTTCAAACTGGG - Intergenic
1200774649 Y:7159634-7159656 GCAGCCCGGAAGTTCAAACTGGG - Intergenic
1201045598 Y:9880314-9880336 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1201171769 Y:11273646-11273668 GCAGCCAGGAAGTTCAAACTGGG - Intergenic
1201244903 Y:11993979-11994001 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1201263308 Y:12181318-12181340 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
1201419460 Y:13782471-13782493 GCAGCAAGGAAGTTCAAACTGGG - Intergenic
1201493121 Y:14564499-14564521 GCTGCCAGGAAGTTCAAACTTGG + Intronic
1201522229 Y:14888180-14888202 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
1201590689 Y:15611366-15611388 GCAGCTGGGAAGCTCAAACTGGG + Intergenic
1201677193 Y:16599767-16599789 GCAGTTTGGAAGGCTAAAGTGGG - Intergenic
1201684310 Y:16683684-16683706 GCAGCCAGGAAGCTCAAACTGGG + Intergenic
1201776151 Y:17668236-17668258 GCAGCTGGGAACTTCAAACTGGG - Intergenic
1201825405 Y:18237756-18237778 GCAGCTGGGAACTTCAAACTGGG + Intergenic
1201929054 Y:19321119-19321141 GCACCTTGGAAGGTTGAAGTGGG - Intergenic
1201979338 Y:19890716-19890738 GTTGCCAGGAAGTTTAAACTGGG - Intergenic
1201988285 Y:19993516-19993538 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
1201992522 Y:20043142-20043164 GCTGCCAGGAAGTTCAAACTGGG - Intergenic
1202026438 Y:20528670-20528692 GCAGCCAGGAAGCTCAAAATGGG + Intergenic
1202064636 Y:20925507-20925529 GCAGCCAGGAAGCTCAAACTGGG - Intergenic