ID: 1154047144

View in Genome Browser
Species Human (GRCh38)
Location 18:10916509-10916531
Sequence AGCACTCGGGCCAGCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154047144_1154047148 -5 Left 1154047144 18:10916509-10916531 CCACACCTGCTGGCCCGAGTGCT No data
Right 1154047148 18:10916527-10916549 GTGCTAAGCCCCTCACTGCCAGG No data
1154047144_1154047159 30 Left 1154047144 18:10916509-10916531 CCACACCTGCTGGCCCGAGTGCT No data
Right 1154047159 18:10916562-10916584 AGCAGGCCGCTCTGAGTGTGGGG No data
1154047144_1154047155 13 Left 1154047144 18:10916509-10916531 CCACACCTGCTGGCCCGAGTGCT No data
Right 1154047155 18:10916545-10916567 CCAGGGCGTGCGGCACCAGCAGG No data
1154047144_1154047157 28 Left 1154047144 18:10916509-10916531 CCACACCTGCTGGCCCGAGTGCT No data
Right 1154047157 18:10916560-10916582 CCAGCAGGCCGCTCTGAGTGTGG No data
1154047144_1154047151 3 Left 1154047144 18:10916509-10916531 CCACACCTGCTGGCCCGAGTGCT No data
Right 1154047151 18:10916535-10916557 CCCCTCACTGCCAGGGCGTGCGG No data
1154047144_1154047158 29 Left 1154047144 18:10916509-10916531 CCACACCTGCTGGCCCGAGTGCT No data
Right 1154047158 18:10916561-10916583 CAGCAGGCCGCTCTGAGTGTGGG No data
1154047144_1154047149 -4 Left 1154047144 18:10916509-10916531 CCACACCTGCTGGCCCGAGTGCT No data
Right 1154047149 18:10916528-10916550 TGCTAAGCCCCTCACTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154047144 Original CRISPR AGCACTCGGGCCAGCAGGTG TGG (reversed) Intronic