ID: 1154049030

View in Genome Browser
Species Human (GRCh38)
Location 18:10935796-10935818
Sequence GCTGCTGGCGAGGCAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2619
Summary {0: 1, 1: 1, 2: 4, 3: 128, 4: 2485}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154049030_1154049035 -7 Left 1154049030 18:10935796-10935818 CCTGCTCCTGCCTCGCCAGCAGC 0: 1
1: 1
2: 4
3: 128
4: 2485
Right 1154049035 18:10935812-10935834 CAGCAGCAACGCTCCGGCAGTGG 0: 1
1: 0
2: 0
3: 13
4: 303
1154049030_1154049036 -3 Left 1154049030 18:10935796-10935818 CCTGCTCCTGCCTCGCCAGCAGC 0: 1
1: 1
2: 4
3: 128
4: 2485
Right 1154049036 18:10935816-10935838 AGCAACGCTCCGGCAGTGGCTGG 0: 1
1: 0
2: 0
3: 2
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154049030 Original CRISPR GCTGCTGGCGAGGCAGGAGC AGG (reversed) Intronic
Too many off-targets to display for this crispr