ID: 1154055568

View in Genome Browser
Species Human (GRCh38)
Location 18:11010164-11010186
Sequence CCATGTACCAAACACCTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154055566_1154055568 25 Left 1154055566 18:11010116-11010138 CCTAATCAAAGACAGATTTCAAA No data
Right 1154055568 18:11010164-11010186 CCATGTACCAAACACCTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154055568 Original CRISPR CCATGTACCAAACACCTACT AGG Intronic