ID: 1154055568

View in Genome Browser
Species Human (GRCh38)
Location 18:11010164-11010186
Sequence CCATGTACCAAACACCTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154055566_1154055568 25 Left 1154055566 18:11010116-11010138 CCTAATCAAAGACAGATTTCAAA 0: 1
1: 0
2: 3
3: 48
4: 475
Right 1154055568 18:11010164-11010186 CCATGTACCAAACACCTACTAGG 0: 1
1: 0
2: 0
3: 28
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154055568 Original CRISPR CCATGTACCAAACACCTACT AGG Intronic
900863517 1:5250613-5250635 CCATGTTGCTGACACCTACTTGG - Intergenic
901309891 1:8261244-8261266 ATATTTATCAAACACCTACTTGG - Intergenic
902252305 1:15162118-15162140 CCAACAACCAAACACCCACTAGG + Intronic
905761519 1:40562190-40562212 CAATGAAACAAACACCTACTTGG - Intergenic
906810782 1:48825030-48825052 CCATGTGCCAAACATGTGCTAGG - Intronic
907545218 1:55253821-55253843 ACATTTACTAAACATCTACTAGG + Intergenic
908492443 1:64659663-64659685 CCATGTGCCAGACACATACTAGG + Intronic
910050977 1:82973657-82973679 CCCTGTAACACACACCCACTGGG + Intergenic
911511846 1:98816694-98816716 CCATTAAACAAACACTTACTAGG - Intergenic
913362331 1:117995414-117995436 CCATGTACTAAACACTGGCTGGG - Intronic
913511735 1:119568656-119568678 CCATGTAACACACACCCACTGGG - Intergenic
914991203 1:152501066-152501088 CTATGTTCCAAACATCTTCTGGG + Intergenic
918130271 1:181621463-181621485 GCATTTACCAAGCACCTAATTGG - Intronic
918399975 1:184153530-184153552 ACATTTACCAAATACCCACTGGG - Intergenic
918614026 1:186523888-186523910 CCATGTAGCAAACTTCTACCTGG - Intergenic
918813392 1:189150146-189150168 CCCTGTAACATACACCCACTGGG + Intergenic
918856470 1:189762303-189762325 CCCTGTACCACACGCCCACTGGG - Intergenic
919415642 1:197305289-197305311 CCATGTACTCAACACCAACAAGG - Intronic
920101484 1:203519726-203519748 CCAGGTGCCGAACACCTCCTAGG + Intergenic
921092167 1:211854770-211854792 CCCTGTAACACACACCCACTGGG - Intergenic
921893837 1:220379129-220379151 CCCTGTAACACACACCCACTGGG - Intergenic
922999166 1:229991948-229991970 CCATGTACCAAAAAGCAACTAGG - Intergenic
924501531 1:244643038-244643060 CCCTGTAACACACACCCACTGGG + Intergenic
924670936 1:246124523-246124545 ACATGTACCCATCACCTATTAGG + Intronic
924849712 1:247814579-247814601 CCATTTCCCAAACCCCTTCTTGG - Intergenic
1064575719 10:16744555-16744577 CAAAGTACCCAACACTTACTAGG + Intronic
1065925729 10:30433064-30433086 CCACGTATCAAGCACCCACTAGG - Intergenic
1068700662 10:60016212-60016234 CCCTGTGCCAAACACATCCTGGG + Intergenic
1070284311 10:75072256-75072278 CCCTGTAACACACACCCACTGGG + Intergenic
1071008332 10:80909586-80909608 CCATGATCCAAACACCTATTAGG + Intergenic
1072525772 10:96270218-96270240 CCTTTTACCAAGCACCTCCTAGG + Intronic
1074746000 10:116533326-116533348 CCATGTAAGAAATACCAACTTGG - Intergenic
1075757438 10:124824770-124824792 CTCTGTACCCAACTCCTACTTGG - Intronic
1077131266 11:973909-973931 ACATCCACCAAGCACCTACTAGG - Intronic
1077586638 11:3458977-3458999 CCCTGTAACACACACCCACTGGG - Intergenic
1077922663 11:6653487-6653509 TCATTTAACAAACACATACTAGG - Intronic
1078113891 11:8425964-8425986 CCCTGTAACACACACCCACTGGG - Intronic
1080127390 11:28752925-28752947 CCATTTACAGAGCACCTACTGGG - Intergenic
1081352124 11:42066604-42066626 CCCTGTAACACACACCCACTGGG + Intergenic
1082626784 11:55496221-55496243 CCATGTAGCAAACTTCTGCTTGG + Intergenic
1082998595 11:59272175-59272197 ACATTGACCAAGCACCTACTGGG - Intergenic
1084937094 11:72592626-72592648 CCATGGACCACACCCCTACCTGG - Intronic
1085191687 11:74631433-74631455 CCATGTACCAAGCACTGTCTTGG - Intronic
1089122148 11:116145055-116145077 CCCTGTAACATACACCCACTAGG + Intergenic
1091227365 11:133965597-133965619 ACGTGTGCCAAGCACCTACTGGG + Intergenic
1091597566 12:1888511-1888533 CCAAATACCAAACACAAACTAGG + Intronic
1093089419 12:14904715-14904737 CCCTGTAACACACACCCACTGGG + Intronic
1094217130 12:27954686-27954708 TCTTGTACCTAACACCTTCTGGG + Intergenic
1095952851 12:47791010-47791032 ACATCTACCAGACACCTTCTAGG + Intronic
1096105281 12:48994073-48994095 GCATGTACTGAGCACCTACTGGG - Intergenic
1096590087 12:52652246-52652268 CCATGTACACAACACCTAGTTGG - Intergenic
1100231262 12:92610476-92610498 CCAGGTACCAAATTCTTACTTGG + Intergenic
1102610300 12:114105994-114106016 CCTTTTACCTAACAGCTACTAGG - Intergenic
1103390099 12:120566181-120566203 ACATGTGCCAAACACCTACACGG - Intronic
1105249374 13:18683937-18683959 ACATTTATCAAACACCTAGTAGG + Intergenic
1105638580 13:22239886-22239908 CCCTGTAACACACACCCACTGGG - Intergenic
1107835926 13:44412618-44412640 ACATTTCCCGAACACCTACTCGG + Intergenic
1108561287 13:51646593-51646615 ACATTTATCAAACACCTACTAGG - Intronic
1111045706 13:82811241-82811263 CCATGATCCAAACACCTCCCTGG + Intergenic
1112394101 13:99012756-99012778 CCATGAACCACACAACTTCTTGG + Intronic
1112941434 13:104866756-104866778 CCCTGTAGCACACACCCACTGGG + Intergenic
1116503573 14:45650530-45650552 CCATGACTCAAACACCTACCAGG + Intergenic
1120540112 14:85740872-85740894 CTATGACCCAAACACCTACCAGG + Intergenic
1121737584 14:96229130-96229152 CCATTTATTAAACACCTACTAGG + Intronic
1122198023 14:100104109-100104131 CTATTTACCAAACACTTACTTGG - Intronic
1122247715 14:100416021-100416043 CCCTGGACCTGACACCTACTAGG - Intronic
1122644298 14:103182439-103182461 CCATGACCCAAACACCTCCACGG - Intergenic
1126721203 15:51582106-51582128 CCATTTATTAAAAACCTACTGGG + Intronic
1128046035 15:64618400-64618422 CCCTGTAACACACACCCACTGGG - Intronic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1141801145 16:86310062-86310084 GCATGGACCCAACACCTAGTGGG - Intergenic
1143292328 17:5840746-5840768 CCCTGTAACACACACCCACTGGG - Intronic
1143864743 17:9915991-9916013 CCCTGCACCAAACCCTTACTTGG - Exonic
1144875850 17:18396816-18396838 CCATGAACCAAGCACCTCCCTGG + Intergenic
1145149256 17:20504282-20504304 CCATGCCCCCAGCACCTACTGGG - Intergenic
1145156379 17:20547604-20547626 CCATGAACCAAGCACCTCCCTGG - Intergenic
1146632668 17:34482190-34482212 GCATTTACCAAGCATCTACTAGG + Intergenic
1150316057 17:64170278-64170300 ACATGTACTGAGCACCTACTAGG + Intronic
1152154573 17:78624260-78624282 CCATGAGACAAACACCTACTTGG - Intergenic
1152501710 17:80715519-80715541 ACAATTACCAAACACCTGCTAGG - Intronic
1153990452 18:10394517-10394539 CCCTGTAACACACGCCTACTGGG - Intergenic
1154055568 18:11010164-11010186 CCATGTACCAAACACCTACTAGG + Intronic
1154435351 18:14337797-14337819 CCATGGACTGAACACTTACTGGG + Intergenic
1154439515 18:14375283-14375305 ACATTTATCAAACACCTAGTAGG - Intergenic
1156945400 18:42823421-42823443 GCATTTATCAAATACCTACTTGG + Intronic
1156996241 18:43470945-43470967 CCAAGGACTAAACACATACTGGG - Intergenic
1157002337 18:43542099-43542121 CACTGTAACACACACCTACTGGG - Intergenic
1158018986 18:52818717-52818739 TCATGTGCTAAACACATACTTGG + Intronic
1159721640 18:71898804-71898826 CCGTGTAACACACACCCACTGGG - Intergenic
1160334223 18:78023152-78023174 CAATTTACTAAACAACTACTTGG + Intergenic
1164594323 19:29524033-29524055 CCATGTACTAGACACTTTCTAGG - Intergenic
1166871399 19:45873054-45873076 CCATGTTCCCAACCCCTGCTAGG - Exonic
1167490746 19:49791658-49791680 TCATTCACCAAGCACCTACTGGG - Intronic
925195050 2:1915971-1915993 CCATGTACCCAGCACACACTTGG - Intronic
926025217 2:9537193-9537215 CCATTTATTGAACACCTACTTGG + Intronic
927729860 2:25461661-25461683 CAATGTACGGAGCACCTACTAGG + Intronic
928537888 2:32257895-32257917 CCCTGTAACACACACCCACTGGG - Intronic
930241963 2:48945061-48945083 CCATATACCAGACACTGACTAGG - Intergenic
931034719 2:58227228-58227250 CCTTGTAACACACACCCACTGGG - Intronic
932576571 2:72965528-72965550 CCCTGTAACATACACCCACTGGG + Intronic
933234104 2:79845328-79845350 CCATGTAGCAGACACTTTCTAGG - Intronic
935882240 2:107576145-107576167 CCATGTAACACACGCCCACTGGG + Intergenic
937697441 2:124823812-124823834 CCATGCACCAGATACCTACTTGG - Intronic
937701515 2:124867819-124867841 CCTTATACCAACTACCTACTGGG + Intronic
937771724 2:125727608-125727630 CCCTGTAACACACACCCACTGGG + Intergenic
937921038 2:127131017-127131039 CCATCTACAAAACACCTTCATGG + Intergenic
938278600 2:130049588-130049610 CCATGAACTGAACACCTGCTGGG - Intergenic
938329577 2:130440447-130440469 CCATGAACTGAACACCTGCTGGG - Intergenic
938360371 2:130681056-130681078 CCATGAACTGAACACCTGCTGGG + Intergenic
938436774 2:131287764-131287786 CCATGAACTGAACACCTGCTGGG + Intronic
940482053 2:154245338-154245360 TCATGGAGAAAACACCTACTAGG - Intronic
940599923 2:155845709-155845731 CCCTGTAACACACACCCACTGGG + Intergenic
941109797 2:161406984-161407006 CCATGTACAAAACAGTTATTAGG - Intronic
942201678 2:173577690-173577712 CCATGTACTAACCATGTACTAGG - Intergenic
943116510 2:183678780-183678802 CCATGATCCAATCACCTACCAGG + Intergenic
943511256 2:188830420-188830442 CCCTGTAGCAAACATCTACCTGG - Intergenic
944985263 2:205168980-205169002 CCATTTATCGAACACCTATTAGG - Intronic
1169652585 20:7885973-7885995 CCATTTACCCCAAACCTACTTGG - Intronic
1170243580 20:14195997-14196019 CCGTGTAACACACACCCACTGGG + Intronic
1172477118 20:35247391-35247413 CCATTTACCAAACATGTGCTGGG + Intronic
1173602597 20:44306742-44306764 CAAGGTGCCAAACACCTTCTGGG + Exonic
1176834401 21:13779503-13779525 ACATTTATCAAACACCTAGTAGG + Intergenic
1179000532 21:37453559-37453581 CCCTGGACCAAACACCTGCTCGG - Intronic
1183040688 22:35175606-35175628 CCTTGTATTAATCACCTACTAGG - Intergenic
1183824751 22:40377196-40377218 CCATGTGCCTACCACCTAGTTGG - Intronic
1184816640 22:46876861-46876883 AGATGTACCAAACACCTATGAGG + Intronic
949444165 3:4115472-4115494 CCCTGTAACACACACCCACTGGG + Intronic
950432712 3:12960166-12960188 CCATTTACTGAACACCTACTAGG + Intronic
951045989 3:18039027-18039049 CCAAGAACCGAACATCTACTGGG + Intronic
952580286 3:34824773-34824795 CCCTGTAACACACACCCACTGGG + Intergenic
954505694 3:51070539-51070561 CCTTTTACCAAACATTTACTTGG - Intronic
954736549 3:52712439-52712461 CCCTGTAACACACACCCACTGGG - Intronic
956007373 3:64795495-64795517 TTATGTAGCAAACAGCTACTAGG - Intergenic
957506625 3:81129536-81129558 CCATGTTCCAATCACCTACCAGG + Intergenic
958427998 3:94001720-94001742 ACATGTATCAAACACCTCCTTGG - Intronic
959071001 3:101701980-101702002 CCAAGTACAAAACACATACAAGG - Intergenic
959409270 3:105999814-105999836 AAATGTACCAAACACTTACTAGG + Intergenic
960415823 3:117383598-117383620 CCCTGTAACACACACCCACTGGG + Intergenic
961266366 3:125646173-125646195 CTCTGTACCAAACACATTCTAGG + Intergenic
962105672 3:132386221-132386243 TCATTTAACAAACACCTACGTGG - Intergenic
963773695 3:149416646-149416668 ACATTTACTGAACACCTACTAGG - Intergenic
965534976 3:169813986-169814008 CCCTGTAACACACGCCTACTGGG - Intergenic
966390382 3:179446910-179446932 CCATGTGCCAAACATATTCTAGG + Intronic
970054616 4:11957010-11957032 CCATGTAACACATACCCACTGGG - Intergenic
971059144 4:22947565-22947587 ACATCTACCGAGCACCTACTAGG - Intergenic
971395141 4:26220416-26220438 TAATTTACCAAATACCTACTGGG + Intronic
973793904 4:54404082-54404104 CCTTGAACCAATCACGTACTGGG + Intergenic
975609633 4:76191403-76191425 CCATGACCCAAACACCTACCAGG - Intronic
979218320 4:118192960-118192982 CCATGTCCCTAACACCCACATGG + Intronic
980202403 4:129673022-129673044 CTATGTAACAAAAACATACTGGG + Intergenic
981100816 4:140827321-140827343 CCATTTACTGAGCACCTACTAGG + Intergenic
981742636 4:148018972-148018994 ACATTTAACAAACACCTACTAGG - Intronic
984081713 4:175255370-175255392 CCCTGTAACACACACCCACTGGG + Intergenic
984263563 4:177470564-177470586 TCATGTAACACACACCCACTGGG - Intergenic
984289823 4:177781414-177781436 CCATTTAACACACACCCACTGGG - Intronic
986549899 5:8940912-8940934 CCATGATCCAATCTCCTACTGGG + Intergenic
988660492 5:33262119-33262141 CCATGTACCAGACACAAACTAGG + Intergenic
993182967 5:84578679-84578701 CCATTTAACAAATAACTACTTGG + Intergenic
994301885 5:98157264-98157286 CCCTGTAACACACACCCACTGGG - Intergenic
996499970 5:124205662-124205684 CTATGTACCAAGCACTTACTAGG + Intergenic
996565866 5:124879498-124879520 CCATGTAACACATACCCACTGGG - Intergenic
998594482 5:143514509-143514531 CCATGTGCCAAACACCATCCTGG - Intergenic
1003257219 6:4484993-4485015 CAATTTAACAAACACTTACTGGG + Intergenic
1003496403 6:6667451-6667473 CCATGTACCAGACACCACCTTGG - Intergenic
1004083343 6:12418485-12418507 CCATGTACCAGGCACCTAATAGG + Intergenic
1004641734 6:17522355-17522377 CCATGTACCAAGCACACACCAGG + Intronic
1004953587 6:20702293-20702315 CCCTGTAACACACGCCTACTGGG - Intronic
1006295921 6:33170064-33170086 CCAGGTTCCCAACACCTCCTGGG + Exonic
1006439555 6:34045452-34045474 GTATGTGTCAAACACCTACTTGG - Intronic
1009943158 6:70313069-70313091 CCTTGTACTAATCACCAACTTGG + Intergenic
1011325652 6:86148141-86148163 CCTTGTAACACACACCCACTGGG - Intergenic
1011371203 6:86638624-86638646 CCATGATCCAAACACCCACTTGG - Intergenic
1011748526 6:90432390-90432412 ACATTTATTAAACACCTACTAGG - Intergenic
1011801632 6:91022378-91022400 CCCTGTAACACACACCCACTGGG + Intergenic
1012294323 6:97501680-97501702 CCATTTATCAAACACCGACCAGG + Intergenic
1013561398 6:111309098-111309120 CCCTGTAACACACACCCACTGGG - Intronic
1013664802 6:112336581-112336603 CTATGTACCAACCATGTACTAGG + Intergenic
1013976692 6:116087355-116087377 CAATGTACCCAACACATACCAGG + Intergenic
1015190318 6:130465118-130465140 CCATGACCCAAACACCTTCCAGG + Intergenic
1015448907 6:133341381-133341403 CCATGTTCCAAACACTTTGTAGG + Intronic
1015503953 6:133962288-133962310 CCATCTACCAAATAGCTACCAGG - Intronic
1017161627 6:151371077-151371099 CCCAGTACAAAACCCCTACTAGG + Intronic
1017629531 6:156382957-156382979 CCATGACCCAAACACCTACCAGG - Intergenic
1018620432 6:165725333-165725355 CCCTGTAACACACACCCACTAGG + Intronic
1024643835 7:51355206-51355228 CCCTGTAACACACACCCACTGGG - Intergenic
1026908440 7:74078042-74078064 CCCTGTAACAACCACGTACTTGG + Intergenic
1027572989 7:79895169-79895191 CCATATGCCAAACACATATTTGG + Intergenic
1027883157 7:83868966-83868988 CCATTTATCAAACTCCTACTGGG + Intergenic
1029645014 7:101849037-101849059 CCAAGGAAGAAACACCTACTTGG - Intronic
1030769547 7:113457086-113457108 CCCTGTAACAAACGCCCACTGGG + Intergenic
1031028929 7:116713499-116713521 CTCTGTACCAAGCACGTACTTGG - Intronic
1039006052 8:33038355-33038377 CAATGTACCAAACATACACTTGG + Intergenic
1041839650 8:62254271-62254293 TCATGTACCTGACAGCTACTTGG - Intronic
1041934750 8:63322649-63322671 CCCTGTAACACACGCCTACTGGG + Intergenic
1046829372 8:118727572-118727594 CTATGTACAAAACACTTAATTGG + Intergenic
1047202073 8:122775763-122775785 CCCTGTAACACACACCCACTGGG - Intergenic
1048531455 8:135253870-135253892 CTTTGTAGCACACACCTACTTGG + Intergenic
1049978830 9:885196-885218 CCCTGTAACACACACCCACTGGG - Intronic
1052881439 9:33603079-33603101 CCATGGACTGAACACCTGCTGGG + Intergenic
1053667316 9:40325251-40325273 CCATGGACTGAACACCCACTGGG + Intronic
1053916895 9:42950355-42950377 CCATGGACTGAACACCCACTGGG + Intergenic
1054378461 9:64465279-64465301 CCATGGACTGAACACCCACTGGG + Intergenic
1054517294 9:66051032-66051054 CCATGGACTGAACACCCACTGGG - Intergenic
1056318136 9:85410835-85410857 CAATGTACCTCATACCTACTTGG + Intergenic
1059469166 9:114491321-114491343 CCATTTCCTAAAAACCTACTCGG + Intronic
1060073212 9:120569017-120569039 ACATGTATTACACACCTACTCGG + Intronic
1060593928 9:124836747-124836769 CCATGTACAAAATACCTTATGGG + Intergenic
1061318678 9:129814344-129814366 CCATGCCACACACACCTACTGGG + Intronic
1061996286 9:134187848-134187870 CCACCAACCAAACACCTGCTGGG - Intergenic
1062376531 9:136264279-136264301 CCATGGACCAGACACCCGCTTGG - Intergenic
1186786341 X:12959502-12959524 TAATCTATCAAACACCTACTGGG + Intergenic
1194680166 X:96842563-96842585 CCATGTATAAAATACCTACTAGG + Intronic
1195724080 X:107896053-107896075 CCATGTTCCAAACAGTTACTTGG + Intronic
1196799664 X:119531289-119531311 CCATGGACCAAGCTCCTGCTGGG + Intergenic
1198884495 X:141319525-141319547 ACATGAAACAAACAACTACTAGG - Intergenic