ID: 1154059754

View in Genome Browser
Species Human (GRCh38)
Location 18:11048095-11048117
Sequence GAGGTGTCACATGCTGTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154059754_1154059759 14 Left 1154059754 18:11048095-11048117 CCACCAACAGCATGTGACACCTC No data
Right 1154059759 18:11048132-11048154 CCCCTGCTCCTGACTGCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154059754 Original CRISPR GAGGTGTCACATGCTGTTGG TGG (reversed) Intronic