ID: 1154059791

View in Genome Browser
Species Human (GRCh38)
Location 18:11048338-11048360
Sequence CTGGGGCCAAGCGGACTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154059782_1154059791 19 Left 1154059782 18:11048296-11048318 CCCACAAGATTGAAAAGACCTGT 0: 1
1: 0
2: 0
3: 14
4: 189
Right 1154059791 18:11048338-11048360 CTGGGGCCAAGCGGACTGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 179
1154059783_1154059791 18 Left 1154059783 18:11048297-11048319 CCACAAGATTGAAAAGACCTGTC 0: 1
1: 0
2: 0
3: 18
4: 128
Right 1154059791 18:11048338-11048360 CTGGGGCCAAGCGGACTGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 179
1154059786_1154059791 1 Left 1154059786 18:11048314-11048336 CCTGTCTTACGGTTACTCATGGC 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1154059791 18:11048338-11048360 CTGGGGCCAAGCGGACTGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154059791 Original CRISPR CTGGGGCCAAGCGGACTGCC TGG Intronic
900100804 1:961200-961222 CTGGGTCCCCGCGGGCTGCCCGG + Intronic
900116519 1:1031529-1031551 GTGGGGCCAGGCTGCCTGCCTGG + Intronic
900164568 1:1239582-1239604 CTGGCCCCAAGAGGACTTCCTGG + Intergenic
900435326 1:2628373-2628395 CTGGAGCCCTGCGCACTGCCTGG - Intronic
900599311 1:3496322-3496344 CTGTGGCCAAGCGTCCTGCTGGG - Intronic
900646354 1:3710420-3710442 CTGGGAGCAAGCGGGCTGCCCGG - Intronic
900782295 1:4626094-4626116 CTGGGGCCAGGCGGAGGGCTGGG + Intergenic
902221020 1:14965246-14965268 CTGGGCTCAAGCAGTCTGCCCGG + Intronic
902374447 1:16023717-16023739 CTGGAGCCAAGCAGACCTCCAGG + Intronic
904283711 1:29439691-29439713 CTGGGGCCACCCTGACTGCTGGG + Intergenic
905805745 1:40876054-40876076 CTGTGGCCAAGTGGACTGAGTGG - Intergenic
906126974 1:43432724-43432746 CTGGGCCCAGGCTGACTCCCTGG - Exonic
906649375 1:47501814-47501836 CTGGCCCCATGCTGACTGCCTGG + Intergenic
906689026 1:47780605-47780627 CTGGGGTCAAGCAGACTTCCTGG + Intronic
908850140 1:68367627-68367649 CTGGGCTCAAGCGATCTGCCTGG - Intergenic
909664900 1:78121765-78121787 CTGTGGCCCAGCACACTGCCTGG + Intronic
910277810 1:85466669-85466691 CTGGGGCTAATGGGGCTGCCTGG - Intronic
911379087 1:97089758-97089780 CTGGGGCCCTGGGGACAGCCTGG - Intronic
912508679 1:110173950-110173972 CTGGGGACAAGCCCACTGCGGGG - Intronic
915169673 1:153969047-153969069 CTGGGGGCAGGGGGACTGTCTGG - Exonic
916560772 1:165932689-165932711 TTGGGGCCAAGGGGGCTTCCTGG - Intergenic
917743563 1:177985520-177985542 CTGGGCTCAAGCGATCTGCCTGG - Intergenic
918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG + Exonic
919598494 1:199593654-199593676 CTGGAGCCAGGCAGACTCCCTGG + Intergenic
922481567 1:225943035-225943057 CCTGGGCCAAGGGGGCTGCCGGG + Intergenic
922729547 1:227942549-227942571 CTGGGGGCCAGGGGACTCCCTGG - Intronic
922729672 1:227942999-227943021 CTGGGGCACAGCTGGCTGCCTGG - Intronic
922753798 1:228083061-228083083 CGGCGTCCAAGCGGACTTCCGGG - Intronic
1063672556 10:8111145-8111167 CTGGGGCCAGGCCGACGGCTTGG + Intergenic
1064092627 10:12397613-12397635 CTGGGGCCTAGGTGAGTGCCTGG + Intronic
1064790370 10:18951541-18951563 CTGGGGCCAGCAGGGCTGCCTGG + Intergenic
1066247093 10:33593919-33593941 CAGGAACCAAGCAGACTGCCTGG - Intergenic
1070841755 10:79492289-79492311 CTGGGGACATGCGGCCTTCCGGG + Intergenic
1076379566 10:130015779-130015801 CTGGGGCCAGGCGGGCAGGCTGG + Intergenic
1076941960 10:133615937-133615959 CTGGGGCCAAGGGGACAGCCTGG - Intergenic
1076980335 11:200756-200778 CTGTGGCCGGGCCGACTGCCTGG - Intronic
1077133776 11:988308-988330 CTAGGACCCAGCGCACTGCCTGG - Intronic
1077181577 11:1219438-1219460 CTGGGGCCCAGCTCAGTGCCTGG + Intergenic
1077808269 11:5610954-5610976 ATGTGGCCAAGAAGACTGCCTGG + Exonic
1078810902 11:14762076-14762098 CTGGGCTCAAGCGATCTGCCAGG - Intronic
1080779850 11:35419754-35419776 CTGGGGCCACGCGGGCTTCAGGG - Intronic
1081668287 11:44929251-44929273 CTGGGGCCAAGAGGACAGCGGGG - Exonic
1082720198 11:56664937-56664959 CTGGGGTCATGAGGAATGCCAGG + Intergenic
1082785624 11:57314722-57314744 CTGGGGACAGGTGGAGTGCCAGG - Intronic
1083636843 11:64125392-64125414 CTGGGGCCCAGCACAGTGCCTGG + Intronic
1083660638 11:64250449-64250471 CTGGGGCAAAGGGGCCTGCAGGG + Intergenic
1084268623 11:68017505-68017527 CTGGGGCCAGGCTGGCTCCCTGG - Intronic
1085421240 11:76362912-76362934 CTGGGGTCAAGCCGTCTACCCGG - Intronic
1088918562 11:114245184-114245206 CCAGAGCCATGCGGACTGCCTGG - Intronic
1090226311 11:125074158-125074180 CTGGGGCAGGGAGGACTGCCAGG - Intronic
1102265709 12:111482957-111482979 CTGGGCTCAAGCGATCTGCCTGG - Intronic
1104091231 12:125519504-125519526 CTGGGGCCCAGCAGATTACCTGG + Exonic
1104159144 12:126161844-126161866 CTGTGGCCAAGCAGACAGCGTGG - Intergenic
1104747462 12:131219420-131219442 GTGGGGCCAAGGGGGCTGGCTGG - Intergenic
1106422285 13:29594794-29594816 CTAGGGACAAGCGGAGAGCCAGG + Intronic
1109349207 13:61155451-61155473 CTGGGTTCAAGTGGTCTGCCTGG + Intergenic
1109687666 13:65843279-65843301 CTGGGGTTATGCGGTCTGCCGGG + Intergenic
1111708336 13:91779587-91779609 CTGGGCTCAAGTGGTCTGCCTGG + Intronic
1113425161 13:110201446-110201468 CCGGGGCCAAGAGGAGAGCCAGG - Exonic
1113462541 13:110492111-110492133 CTGGGGCGGATTGGACTGCCTGG + Exonic
1118503725 14:66388477-66388499 CTGGGGCCAAGAACAATGCCTGG - Intergenic
1118996381 14:70840338-70840360 CTGGGGCCCAGCACACTGCCTGG - Intergenic
1121466190 14:94116845-94116867 CTGGGGCCCAGCCCAGTGCCTGG - Intergenic
1122047403 14:99034038-99034060 GTGGGGCCCAGCTGGCTGCCAGG + Intergenic
1122606450 14:102949943-102949965 ATGGGGCCTGGCGGCCTGCCTGG - Intronic
1124363963 15:29058655-29058677 CTGAGACCAAGAGGTCTGCCCGG + Intronic
1128452199 15:67812078-67812100 CTGGGGCCAGGTGGACCCCCAGG + Intergenic
1128575931 15:68775127-68775149 CTGGGGCCTGTCAGACTGCCAGG - Intergenic
1130276113 15:82477148-82477170 CTGGGGCCCCTCGGACGGCCTGG + Intergenic
1130585776 15:85180739-85180761 CTGGGACCAGGGGTACTGCCAGG + Intergenic
1131187085 15:90283903-90283925 CTGGGACCAGGGGTACTGCCAGG + Intronic
1132636514 16:952466-952488 CTGGGGCCACGTGCACTTCCGGG - Intronic
1132700642 16:1220682-1220704 CTGGGGCCAGGCCTCCTGCCGGG + Exonic
1138125376 16:54434074-54434096 CTGGGGACCAGCTGAATGCCTGG + Intergenic
1139301508 16:65948910-65948932 CTGGGGCCAAGGTGAGTGCATGG + Intergenic
1139478936 16:67217647-67217669 CTGGTGCCCAGCACACTGCCCGG + Intronic
1139779678 16:69340104-69340126 CTGGGTCCATGCTGCCTGCCCGG - Intronic
1141565695 16:84900114-84900136 CTGCGGCCAAGCGTTCTGCCTGG + Intronic
1142036480 16:87865392-87865414 CTGGGACCAAAAGGACTGCTTGG + Intronic
1142596486 17:1032144-1032166 CAGGGGCCAAGCGGAGGGGCCGG + Intronic
1146255703 17:31390815-31390837 CTTGGGGCATGCGGGCTGCCAGG + Intergenic
1146686478 17:34844688-34844710 CTGGGGCCATAGGGACTTCCTGG - Intergenic
1147428607 17:40357753-40357775 CTGGGGCCAAGGGGCTGGCCAGG + Intergenic
1149997109 17:61411213-61411235 CTGGGGCCCCGCGGAGCGCCGGG - Intergenic
1151406927 17:73893950-73893972 CTGGGGCCCATCTGATTGCCTGG - Intergenic
1151458776 17:74242337-74242359 CTGGTGCCAAGCTCAGTGCCTGG + Intronic
1151562077 17:74875808-74875830 CTCGTGCCAAGAGGGCTGCCTGG + Intergenic
1153853897 18:9125791-9125813 CTGGGGCCAGCAGTACTGCCAGG - Intronic
1154059791 18:11048338-11048360 CTGGGGCCAAGCGGACTGCCTGG + Intronic
1160385921 18:78496216-78496238 CTGGGGCGGAGCCGACTTCCAGG + Intergenic
1160874780 19:1291878-1291900 CTGGGGCCTGGAGGGCTGCCTGG + Intronic
1161073428 19:2273637-2273659 CTGGCGCCAAGCTGAGGGCCCGG - Intronic
1161770321 19:6227338-6227360 GTGGGGCCACGCGGCCTTCCGGG + Intronic
1162042288 19:7978136-7978158 CTAGGGCCAAGCCCTCTGCCAGG - Intronic
1162084826 19:8242182-8242204 CTGGAGCCCAGCAGACTGGCTGG - Intronic
1162800071 19:13105300-13105322 ATGTGGCCCAGCGGGCTGCCCGG - Exonic
1163099305 19:15084175-15084197 CTGGGGCTGAGCGAGCTGCCAGG - Intergenic
1165920411 19:39294189-39294211 CTGGGGGCAAGCGCATTTCCTGG - Intergenic
1166000599 19:39875419-39875441 CTGGGCCCCAGCGGCCTGACAGG + Exonic
1166003397 19:39891674-39891696 CTGGGCCCCAGCGGCCTGACAGG + Exonic
1166189117 19:41163736-41163758 CTGGGCCCAAGCAATCTGCCCGG - Intergenic
1166373629 19:42315500-42315522 CTGGGCCTAAGAGGAATGCCTGG + Intronic
1167388423 19:49178427-49178449 CTGGGGCCAGGAGGACAGTCGGG + Intronic
925155342 2:1644669-1644691 GTGGGGCCCAGCCGGCTGCCAGG + Exonic
925307877 2:2862751-2862773 CTGGGGCCACACAGACTGCCTGG + Intergenic
932628602 2:73319069-73319091 CTGGGCTCAAGCGATCTGCCTGG + Intergenic
933846889 2:86334022-86334044 CTGGGGACAAGCAGAGTGGCTGG - Intronic
934568700 2:95354660-95354682 GCGGGGCCAAGGGGACTACCAGG + Intronic
938071396 2:128310304-128310326 CTGGGGCCCAGCTCACTGCGGGG - Intronic
947014987 2:225609498-225609520 CTGGCCCCAAGCTGACTTCCAGG - Intronic
947778409 2:232734176-232734198 CTGGGCCCAAGCCGTCTGCCTGG + Intronic
948275616 2:236705726-236705748 CTGGAGTCAAGCTGTCTGCCTGG + Intergenic
948885242 2:240878958-240878980 CTGGGGCCAGGGAGGCTGCCTGG - Exonic
1170557916 20:17530553-17530575 CTGGGGCAAAGGGGACTGACTGG + Intronic
1172460934 20:35118128-35118150 CTTGGGCCTAGCAGAGTGCCTGG + Intronic
1173821598 20:46023173-46023195 CTGGGGCCATTCGGAATTCCAGG - Intronic
1175794987 20:61765784-61765806 GTGGGGGCAAGGGGACTGGCAGG + Intronic
1176013516 20:62914286-62914308 CTGGGTCCAAGCAGACAGCCAGG + Exonic
1176115652 20:63430882-63430904 CTGGGGCCAAGGGTGCTCCCAGG - Intronic
1177404240 21:20645454-20645476 CTGGGGGCAAGGGAACTTCCTGG - Intergenic
1180182617 21:46124684-46124706 CGGGGGCCAAGAGGAGTCCCAGG + Exonic
1180495536 22:15889215-15889237 CTGGGGCCCAGCGATCTACCTGG + Intergenic
1181022236 22:20109588-20109610 CTGGAGCCAGTGGGACTGCCTGG + Intronic
1184213605 22:43051708-43051730 CTGGGGCCTGGGGGACTGCTGGG + Intronic
1184766408 22:46574878-46574900 CTTGAGCCAAGGGGACTGCGGGG - Intergenic
1184773120 22:46609618-46609640 CTGGGGCCCAGCACACGGCCTGG - Intronic
949351208 3:3126747-3126769 CTGGGGCGAAGCGGAGCCCCGGG - Intergenic
950134515 3:10571279-10571301 ATGAGGCCAGGAGGACTGCCTGG + Intronic
953361308 3:42299679-42299701 CTGGGGCCAAAAGGACTGGAGGG + Intergenic
953860837 3:46542948-46542970 CAGGGGCCAGGCAGGCTGCCAGG + Intronic
954197301 3:49004332-49004354 CTGGGGCCAAGAGGACAGAATGG + Intronic
954422498 3:50426047-50426069 CTGGGGCAAAGGGGAAGGCCAGG - Intronic
957638184 3:82814774-82814796 CTGGGGCCAATCAGCCTGGCAGG + Intergenic
958921005 3:100105482-100105504 CTGGGGCAAAAGGGACTTCCAGG + Intronic
961523995 3:127484930-127484952 CTGGGGCCAGGAGGAATGCCTGG + Intergenic
962809268 3:138947290-138947312 CAGGGGCCCAGCCGACAGCCAGG + Exonic
963796074 3:149632138-149632160 CTGGGTTCAAGCGATCTGCCTGG + Intronic
968565080 4:1307830-1307852 CTGGGCCCCAGCGGACTGGATGG + Intronic
969850373 4:9951915-9951937 GTGGGGTTAAGCTGACTGCCTGG + Intronic
970504289 4:16711312-16711334 CTGGGGCCAAGCTCAGTGCCTGG - Intronic
971003581 4:22349902-22349924 CTGGGCTCAAGCAGTCTGCCTGG - Intronic
971232046 4:24807869-24807891 CAGGGCCCAGGAGGACTGCCTGG - Exonic
973218121 4:47694693-47694715 CTAGGACCCAGCGGAGTGCCTGG + Intronic
975462139 4:74665819-74665841 CTGGGGCCTAGCAGAGTGTCTGG - Intergenic
983541481 4:168916182-168916204 CTGGGATCAAGCGATCTGCCCGG - Intronic
986814696 5:11395912-11395934 TTGGGGCCATGTGGCCTGCCAGG + Intronic
991975102 5:72177476-72177498 CTGGGGCCCAGAGGCCTGGCCGG - Intronic
992108184 5:73467845-73467867 CTGGGGCCTAGCAAAGTGCCAGG - Intergenic
992364785 5:76080896-76080918 CTGGGGCCAAGGTGTGTGCCAGG + Intergenic
997528387 5:134567809-134567831 CTGGTGGCAAGCTGGCTGCCAGG - Intronic
1000850291 5:166331487-166331509 CTGGGGACAAGTGGGTTGCCTGG - Intergenic
1001846288 5:174924385-174924407 CTGGGACCAGGGGTACTGCCAGG - Intergenic
1002304073 5:178273205-178273227 TTGAGGCCAAGGGGACAGCCTGG - Intronic
1002424767 5:179168421-179168443 CAGGGGGCGAGCGGCCTGCCCGG - Intronic
1003134973 6:3427988-3428010 CTGGGGACAAGCGGACTGAGAGG + Intronic
1004705774 6:18122450-18122472 CTGCGGCCACGTGGTCTGCCTGG - Exonic
1006582016 6:35082732-35082754 CTGGGGCGTAGGGGGCTGCCAGG - Exonic
1007596150 6:43052605-43052627 CTCTGGCCAAGTGGACTGCAAGG - Exonic
1011032616 6:82940129-82940151 ATGGGGCCAGGCAGACAGCCTGG - Intronic
1016569824 6:145498802-145498824 GTGGGGCCAAGTTGACTGACTGG - Intergenic
1016994934 6:149954802-149954824 CTCGGGCGAAGCGGACGCCCTGG + Intergenic
1017003675 6:150014634-150014656 CTCGGGCGAAGCGGACGCCCTGG - Intergenic
1018700807 6:166424546-166424568 CTGGGACCAAGAGCACTGCCTGG + Intronic
1019493111 7:1324219-1324241 CTGTGGACAAGCTGGCTGCCCGG - Intergenic
1020023519 7:4883278-4883300 CGGGGCCCACGCGGACAGCCAGG + Intronic
1022854818 7:34304006-34304028 TTGGGGCCAAGGGGACAGGCGGG + Intergenic
1024648588 7:51387616-51387638 CTGGGCGCACGCGGGCTGCCGGG + Intergenic
1032390946 7:131555211-131555233 CTAGGGCCAGGAGGACTGCGGGG - Intronic
1035039379 7:155916461-155916483 CTGGTGCCCAGCCCACTGCCTGG + Intergenic
1035195712 7:157218675-157218697 CTGGAGCCAAGCACCCTGCCAGG - Intronic
1037051665 8:14381544-14381566 CTGGGCTCAAGCGATCTGCCTGG - Intronic
1037282057 8:17252404-17252426 CTGGGCCCAAGCACTCTGCCTGG + Intronic
1043796860 8:84553370-84553392 CTGAGGCCAAGAGACCTGCCTGG - Intronic
1049073967 8:140379156-140379178 CTGGGGCCACAGGGCCTGCCCGG + Intronic
1049791161 8:144473312-144473334 CTGGGGCATGGAGGACTGCCAGG - Exonic
1053123767 9:35563667-35563689 ATGGGGCCAAGCGGACAGGTTGG - Intronic
1056732814 9:89180421-89180443 CTGGAGCCCAGGGGATTGCCTGG - Intergenic
1060742886 9:126111163-126111185 CTGGGCCCAAGGGGAGGGCCTGG + Intergenic
1060827921 9:126696904-126696926 CTGGGGGCAGGCCCACTGCCTGG + Exonic
1062213906 9:135378783-135378805 CTGGGGCCATGCAGAGTGGCTGG - Intergenic
1203761015 EBV:13031-13053 CTGGGGCCGCCCGGGCTGCCGGG - Intergenic
1203761944 EBV:16103-16125 CTGGGGCCGCCCGGGCTGCCGGG - Intergenic
1203762873 EBV:19175-19197 CTGGGGCCGCCCGGGCTGCCGGG - Intergenic
1203763802 EBV:22247-22269 CTGGGGCCGCCCGGGCTGCCGGG - Intergenic
1203764731 EBV:25319-25341 CTGGGGCCGCCCGGGCTGCCGGG - Intergenic
1203765660 EBV:28391-28413 CTGGGGCCGCCCGGGCTGCCGGG - Intergenic
1203766589 EBV:31463-31485 CTGGGGCCGCCCGGGCTGCCGGG - Intergenic
1203767518 EBV:34535-34557 CTGGGGCCGCCCGGGCTGCCGGG - Intergenic
1188534378 X:31180186-31180208 CTGGTGCCTAGGGGAGTGCCTGG - Intronic
1189278183 X:39802656-39802678 CTGGGGACAAGTGCACAGCCGGG - Intergenic
1191213080 X:57909645-57909667 CTGGGCCCCCGCGGACTGCTGGG - Exonic
1192080638 X:68044778-68044800 CTGGGGACCAGCAGTCTGCCTGG - Exonic
1195684271 X:107571452-107571474 CTGGGGCCAAGTTGGCTGTCTGG + Intronic
1198802289 X:140460184-140460206 CTGGGGCCCAGCATACTGCAGGG - Intergenic