ID: 1154059990

View in Genome Browser
Species Human (GRCh38)
Location 18:11050746-11050768
Sequence TTGGAGAGGCAGAATTAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 447}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154059990 Original CRISPR TTGGAGAGGCAGAATTAGAA AGG (reversed) Intronic
902074223 1:13769912-13769934 TTGGATTGTCACAATTAGAAGGG + Intronic
902269759 1:15294934-15294956 TGAGGGAGGAAGAATTAGAATGG + Intronic
902880026 1:19365878-19365900 TTGATGAGGCAGAAGTAGAAGGG + Intronic
903270284 1:22183963-22183985 GTGGAGAGGTATAATAAGAAGGG + Intergenic
903733480 1:25515146-25515168 TTGGAGAGGCAGGTGGAGAATGG - Intergenic
903759058 1:25685069-25685091 TTGGAGAGCCAGTATTTTAAAGG + Intronic
904200355 1:28815501-28815523 TTGGGGAGGCTGAATGATAAGGG + Intronic
904589866 1:31607029-31607051 CTGGAGAGGAAGAAATAAAATGG - Intergenic
905349689 1:37336874-37336896 TTGAAGAGGCAGAAGTGGGAGGG + Intergenic
906542021 1:46594282-46594304 TTGAAAAAGCAGAAATAGAAAGG + Intronic
907256002 1:53179669-53179691 TTGGTGAGGCAGGATAAGGAAGG - Intergenic
907611715 1:55877761-55877783 GTGGAGAGGCAGAGTCAAAAAGG + Intergenic
907972575 1:59398014-59398036 CTGGAGAAACAAAATTAGAAGGG - Intronic
908031574 1:60005677-60005699 TGGGTGAGGCAGAATGAAAAGGG + Intronic
908257892 1:62317986-62318008 TTGAAAAGGCAGTATTAGAACGG + Intronic
909482440 1:76140550-76140572 TGGGAGAGGCAGAAGTAAACAGG - Intronic
910427594 1:87132231-87132253 TTGGAGCGGCATCATTACAAGGG + Intronic
911337530 1:96598748-96598770 TTGGAGAGACTGATTTATAAAGG + Intergenic
911803329 1:102173653-102173675 TTGGAAAAGAAAAATTAGAATGG + Intergenic
912308259 1:108593385-108593407 TTGGAAAGGCAGAGTAAGAGAGG - Intronic
912708148 1:111930078-111930100 TTAGGTAGGCAGATTTAGAAGGG + Intronic
915516272 1:156414437-156414459 TTGGGGAGTCTGAATGAGAAGGG - Intronic
915680428 1:157576705-157576727 TTTGAATGGCAGCATTAGAATGG - Intronic
916404453 1:164484099-164484121 TTGGAGAAGCATATTTAAAAAGG - Intergenic
916461130 1:165025789-165025811 TTTCAGAGACAGAATTATAAGGG - Intergenic
917245814 1:172999082-172999104 TTAGAGAGGAAGGAATAGAAGGG + Intergenic
918598201 1:186318446-186318468 TTGTGGAGGCAGAATCTGAAGGG - Exonic
918656734 1:187036081-187036103 AAGGAGAGGCAGAATTAGTTTGG - Intergenic
919440810 1:197631041-197631063 TCTGAGAGTGAGAATTAGAAAGG - Intronic
920796262 1:209140118-209140140 TTGTAGAGGTGGAAGTAGAAGGG + Intergenic
921627633 1:217395317-217395339 TTGGAGAGAGAGAAAAAGAAGGG - Intergenic
921823796 1:219648494-219648516 GTGTAGAGGGAGAATTACAAAGG - Intergenic
921898885 1:220429424-220429446 TTGGAGAGGCAGAATAACAATGG + Intergenic
922092771 1:222413067-222413089 TTTGATAGGCAGAGATAGAAAGG - Intergenic
922504539 1:226118901-226118923 TTGGAGAGCCAGAACAAGGATGG + Intergenic
922972702 1:229756490-229756512 TTGCAGGGTCAGAATTTGAATGG + Intergenic
923260549 1:232264006-232264028 ATGGAGAGGCAGAACTGGACTGG - Intergenic
924506049 1:244684992-244685014 TTGGAGAGCCAGAATTTGGATGG - Intronic
924728105 1:246688697-246688719 TTGGAGAGGCGGAGGTGGAAGGG - Intergenic
1063105572 10:2988751-2988773 ATGGAGAGGCACAACTAGAAGGG + Intergenic
1063113506 10:3056492-3056514 TTGGAAGTGCAGAAATAGAATGG + Intergenic
1064363616 10:14687705-14687727 TTTTAGAGGCAGAAATGGAATGG - Intronic
1064396597 10:14987239-14987261 TTGGAGAGGAAGAAGTACATGGG + Intronic
1064398384 10:14999860-14999882 TTGGAGAGGAAGAAGTACATGGG + Intergenic
1064399389 10:15008632-15008654 TTGGAGAGGAAGAAGTACATGGG + Intergenic
1066170907 10:32844131-32844153 TTGAACAGGGACAATTAGAATGG - Intronic
1066736929 10:38488163-38488185 ATGGAGTGGAAGAATAAGAATGG + Intergenic
1068093679 10:52464116-52464138 TTGGAGTGGAAGTAGTAGAATGG + Intergenic
1068168778 10:53365891-53365913 TTTGAGAAGCAGAATGGGAATGG + Intergenic
1068859885 10:61837140-61837162 TGGGGGAGGCAGAATTTAAAGGG - Intergenic
1070292800 10:75131247-75131269 GAGAAGAAGCAGAATTAGAATGG - Intronic
1070394928 10:76003637-76003659 CAGGAGAGGCAGCATTAGGAAGG + Intronic
1071176559 10:82932924-82932946 TTGGAAAAGGAGAGTTAGAAAGG - Intronic
1071435064 10:85641285-85641307 TTGGAGATGCAGAATTGGCCTGG - Intronic
1071450952 10:85791001-85791023 TGGGAAAGGCAGGATTAGAAGGG - Intronic
1071958878 10:90788488-90788510 TCGGAGACCAAGAATTAGAATGG + Intronic
1072324894 10:94288232-94288254 TTGGAGACTCAGAATGAGAGTGG - Intronic
1072841575 10:98780118-98780140 GTAGGAAGGCAGAATTAGAAAGG + Intronic
1072849392 10:98871676-98871698 TTGGACAGGCAGATTTAGTAGGG + Intronic
1073046424 10:100641703-100641725 TTGGACAGGTAGATTTAGTAGGG + Intergenic
1073090054 10:100928618-100928640 TTGGAGAGGCAGTATAAGCAAGG + Intronic
1073755162 10:106573329-106573351 TTGGAAAGGCAGAGCTGGAAGGG + Intergenic
1074138662 10:110651058-110651080 CTGGAGAGGCTAGATTAGAAAGG - Intronic
1074161185 10:110837527-110837549 TTGGGCAGGCAGACTGAGAAGGG + Exonic
1074435937 10:113434401-113434423 ATGGAAAGGCAGAATTCAAACGG - Intergenic
1074895784 10:117776559-117776581 GTGGAGAGGCAGAATCCCAAGGG + Intergenic
1075400153 10:122155213-122155235 CTGGAGAGGCAGGTTGAGAAGGG - Intronic
1076771528 10:132668663-132668685 TTGCACAGGGAGCATTAGAAGGG + Intronic
1077739860 11:4833775-4833797 TTGGAGAGGAAGTTATAGAAGGG + Intronic
1078832191 11:14988436-14988458 TTGGAGAGGAAGAAGTACATGGG + Intronic
1079040155 11:17052226-17052248 TTGGAGAGGAAGAAGTACATGGG - Intergenic
1079146727 11:17858832-17858854 TTGGAGAGGGTGAATTGGAGAGG + Intronic
1079779045 11:24575254-24575276 TAAGAAAAGCAGAATTAGAAAGG - Intronic
1080785757 11:35473622-35473644 TTGAAGAGGAAGATTGAGAAGGG + Intronic
1080907895 11:36565075-36565097 TTTGAAAGCCAGAACTAGAAGGG - Intronic
1081593666 11:44444521-44444543 GTGGAGAGGCAGAGGTGGAATGG + Intergenic
1082173456 11:49034230-49034252 TTGGAGATGCTGAAAAAGAAGGG + Exonic
1082207166 11:49451675-49451697 TAGGAGAATAAGAATTAGAAAGG - Intergenic
1082241142 11:49871950-49871972 TTGGAGATGCTGAAAAAGAAGGG - Intergenic
1082251511 11:49986553-49986575 TTTTAAAGGCAGAATAAGAAAGG - Intergenic
1082556450 11:54568302-54568324 TGGGAGGGGCAGAATGAGATTGG + Intergenic
1082608144 11:55267491-55267513 TTGGAGATGCTGAAAAAGAAGGG + Intronic
1082666289 11:55979886-55979908 TTGGAGAGGAAGAAGTACATGGG + Intergenic
1083935291 11:65866844-65866866 TGTGAGGGGCAGAATGAGAAAGG - Exonic
1084227064 11:67723228-67723250 TTGGAGAGGAAGAAGTACATGGG + Intergenic
1084808128 11:71593628-71593650 TTGGAGAGGAAGAAGTACATGGG - Intronic
1084846334 11:71903361-71903383 TTGGAGAGGAAGAAGTACATGGG - Intronic
1084903644 11:72329178-72329200 TTGGGAAAACAGAATTAGAATGG + Intronic
1085828398 11:79872945-79872967 TTCTAGATGCAAAATTAGAAAGG + Intergenic
1085844161 11:80046660-80046682 CTGCTGAGGCAGGATTAGAAAGG - Intergenic
1086441436 11:86833266-86833288 TTGGAGAGGAAGAAGTACATGGG + Intronic
1086444270 11:86857821-86857843 TTGGAGAGGAAGAAGTACATGGG + Intronic
1086592314 11:88530136-88530158 TTGGACAGGTAGAATGAGCATGG - Intronic
1086648110 11:89250061-89250083 TAGGAGAATAAGAATTAGAAAGG + Intronic
1086692309 11:89801826-89801848 TTGGAGATGCTGAAAAAGAAGGG - Exonic
1086696066 11:89847383-89847405 TTGGAGATGCTGAAAAAGAAGGG + Intergenic
1086702462 11:89915036-89915058 TTGGAGATGCTGAAAAAGAAGGG - Exonic
1086703705 11:89929414-89929436 TTGGAGATGCTGAAAAAGAAGGG + Intergenic
1086710090 11:89997106-89997128 TTGGAGATGCTGAAAAAGAAGGG - Intergenic
1086713490 11:90037833-90037855 TTGGAGATGCTGAAAAAGAAGGG + Exonic
1088095178 11:106091446-106091468 ATGGAGAGGAAGAAAAAGAATGG + Exonic
1090256576 11:125288584-125288606 TTGGAAAGGCAGACATAAAAGGG - Intronic
1090297194 11:125599125-125599147 TAGGAGAGGCAGAGTGAGAGAGG - Intronic
1090386954 11:126362972-126362994 CTGGAGAGGCAGAGAGAGAAGGG - Intronic
1091141826 11:133241882-133241904 TAGGATAGGCAGGATTTGAAGGG - Intronic
1091638662 12:2217211-2217233 TTATAGAGACAGAAGTAGAATGG + Intronic
1092431763 12:8415549-8415571 TTGGAGAGGAAGAAGTACATGGG + Intergenic
1092433604 12:8428415-8428437 TTGGAGAGGAAGAAGTACATGGG + Intergenic
1092434714 12:8438169-8438191 TTGGAGAGGAAGAAGTACATGGG + Intergenic
1093615842 12:21223207-21223229 TAGGATACTCAGAATTAGAATGG - Intronic
1093715157 12:22373421-22373443 GAGGAGAGACAGGATTAGAAAGG + Intronic
1096803870 12:54128406-54128428 TTGGAGAGGCAGGAGCAAAAAGG - Intergenic
1097867779 12:64573665-64573687 TTGGAGAGGCCCAAATAGCAAGG - Intergenic
1098389622 12:69955731-69955753 TTGGTGAGAGAGAATTGGAATGG + Intronic
1099150999 12:79113873-79113895 TTTTTGAGGCAGAATTAGATAGG - Intronic
1100009701 12:89938564-89938586 TTGGAGAGGTAAACTCAGAAGGG - Intergenic
1101205733 12:102485284-102485306 TTGGAGATTCAGGATCAGAAAGG - Intergenic
1102791846 12:115653110-115653132 TTACAGAAGCAGAAATAGAAGGG - Intergenic
1105832257 13:24173625-24173647 TTAGAGAGACAGGAATAGAAGGG - Intronic
1106451523 13:29886805-29886827 TGGCAAAGGCAGAATTTGAATGG - Intergenic
1106455293 13:29921465-29921487 CAGGAGAGGCAGAATTAGTCAGG - Intergenic
1107059376 13:36140083-36140105 GGGGAGAGGAAGAAGTAGAAGGG + Intergenic
1107160578 13:37222597-37222619 TTGAAGATGCAGAAAAAGAATGG - Intergenic
1107308630 13:39050990-39051012 TTGGATAGTCAGCATTAAAATGG + Intergenic
1107402670 13:40084661-40084683 TTGGAGTGGCTGAATCAGGATGG - Intergenic
1107451638 13:40515446-40515468 TGTGAAAGGCAGGATTAGAATGG - Intergenic
1107545745 13:41432012-41432034 TTGGAGAGGAAGAAGTACATGGG + Intergenic
1107546760 13:41440606-41440628 TTGGAGAGGAAGAAGTACATGGG + Intergenic
1107547004 13:41442894-41442916 TTGGAGAGGAAGAAGTACATGGG - Intergenic
1108313813 13:49219762-49219784 TTGTAGAGCCAGGATTAGACAGG + Intergenic
1108347856 13:49564134-49564156 TTGAAGAGGCAGAGTAAAAAAGG + Intronic
1108420610 13:50245311-50245333 ATGAAGAAGCAGAATTAGAGAGG - Intronic
1108516611 13:51209267-51209289 TTGGAGAGGCACAATTAGAGTGG + Intergenic
1109511529 13:63381272-63381294 TTGGAGAGTGAGAAATTGAATGG - Intergenic
1109839356 13:67902427-67902449 TTGGAGAGGAAGAAGTACATGGG - Intergenic
1112856797 13:103781673-103781695 TTGGAGTTGCAGAATAAAAATGG + Intergenic
1113019028 13:105861383-105861405 TTGAAAAGGCAGATTTAGAGAGG - Intergenic
1114472551 14:22973839-22973861 TGGGAGAGTCAGATTCAGAAAGG + Intronic
1114496757 14:23138123-23138145 TTGGCGAGAGAGAATTAGCAAGG - Intronic
1114706123 14:24728043-24728065 TTGGAGTACCAGAATTAGATGGG + Intergenic
1114718771 14:24857541-24857563 TGGGAAAGGCTGAATTTGAAAGG + Intronic
1115008510 14:28515859-28515881 TTTGATATGCAGAATTAGGAAGG + Intergenic
1115091728 14:29585071-29585093 GTGGTGAGGCAGAATTGAAAGGG - Intronic
1115366599 14:32564475-32564497 TTGGAAAGGCAGCAATAGATTGG + Intronic
1116072809 14:40070899-40070921 TTTGCTAGGCAGAATTATAATGG - Intergenic
1117029038 14:51651220-51651242 CTGGAGAGGTAGAATTAGAGGGG + Intronic
1117039556 14:51757194-51757216 TTGGAGAGGAAGAAGTACATGGG - Intergenic
1117040380 14:51763836-51763858 TTGGAGAGGAAGAAGTACATGGG + Intergenic
1117252709 14:53952597-53952619 TGGGGGAGGGAGAATTAAAATGG + Intronic
1118042683 14:61934678-61934700 AGTGAGAGGCAGAACTAGAATGG - Intergenic
1119268775 14:73282489-73282511 TTGCAGTGCCAGAAGTAGAAGGG - Exonic
1119272720 14:73323788-73323810 TTGAAGAGGCAAAAATTGAAAGG + Intronic
1119645244 14:76343220-76343242 TTGGAGAGACAGATTAAGCAGGG + Intronic
1120264234 14:82228956-82228978 TTTGCTAGGAAGAATTAGAAGGG + Intergenic
1120404165 14:84073296-84073318 GTGGAGAGGCAGAAAGACAAGGG + Intergenic
1121165240 14:91790018-91790040 TTGGGGAGTCAGGATTTGAATGG - Intronic
1121312887 14:92944652-92944674 TTTGAGTGGCAGAATGAAAAGGG - Intronic
1121834736 14:97081743-97081765 TTGAAAAGGCAAAATTATAAGGG - Intergenic
1122501146 14:102200560-102200582 TTGGGGAGGAAGAGTTACAAAGG + Intronic
1202895485 14_GL000194v1_random:5265-5287 CTGCAGAGACAGAATTAAAAGGG + Intergenic
1123955758 15:25332790-25332812 TGGGAGAGGCAGAGACAGAACGG + Intergenic
1124216451 15:27811348-27811370 TTGGAGATTCAGAATGGGAAGGG + Intronic
1125338536 15:38652060-38652082 TTGGAGAGGCAGGAAGAGAGGGG - Intergenic
1125928168 15:43580514-43580536 TGGGAGGGGCAGTGTTAGAAAGG + Intronic
1125941312 15:43680072-43680094 TGGGAGGGGCAGTGTTAGAAAGG + Intergenic
1125941333 15:43680348-43680370 TGGGAGGGGCAGTGTTAGAAAGG + Intergenic
1126542632 15:49839657-49839679 TTAGGCAGGCAGCATTAGAAGGG + Intergenic
1126788544 15:52199241-52199263 TTGAATAGGGTGAATTAGAAGGG - Intronic
1128920336 15:71604540-71604562 TTCAAGAGGAAGAATTAGAAAGG + Intronic
1129302720 15:74635225-74635247 TTGGAGAGGGAGAAGCATAAGGG + Intronic
1131127904 15:89870959-89870981 TATCAGAGGCAGAATTAAAATGG - Intronic
1131781172 15:95861404-95861426 ATGGAGAGCCAAAATAAGAATGG - Intergenic
1132242833 15:100273373-100273395 TTGAAGAGTCATAATTAGTAAGG - Intronic
1133488904 16:6248222-6248244 TTGGAGGCCTAGAATTAGAATGG + Intronic
1134038103 16:11047463-11047485 ATGGGGAAGCAGATTTAGAATGG + Intronic
1134306046 16:13033452-13033474 TTAGAGAAGCAGAAAAAGAAAGG - Intronic
1135857735 16:26027523-26027545 TTGGAGAAGCAAAATGAGATAGG - Intronic
1137771900 16:51023238-51023260 TGCGAGAGGCAGAATAATAATGG - Intergenic
1137846606 16:51695962-51695984 CTGGAGAGGCTGAAGTGGAAGGG + Intergenic
1137870186 16:51942846-51942868 TTGCAAAGTCAGAATTGGAAAGG - Intergenic
1139617504 16:68107379-68107401 TTGGCGAGGCTGAGATAGAAAGG - Intronic
1140482784 16:75271300-75271322 TTATAGAGACAGAAGTAGAATGG - Intergenic
1143480943 17:7227029-7227051 TTGGAGAGGCAGAACAAGGTAGG + Intronic
1143643097 17:8210705-8210727 TGGAAGAGGCGGAATGAGAAGGG + Intergenic
1144789269 17:17848353-17848375 TTGGGGAGGCAGGATGTGAAGGG + Intronic
1144909418 17:18668725-18668747 TTGCAGAGGCAGTAGTAGCATGG - Intronic
1145058957 17:19720467-19720489 ATGGAGAGGGAGGAATAGAAAGG - Intergenic
1146338696 17:31999379-31999401 TTGGGGAGGGAAAATTGGAATGG + Exonic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1146799513 17:35807480-35807502 TTGGAGAGACAGAAATAGGAAGG - Intronic
1148885399 17:50768518-50768540 ATGGAGAGGCGGAAGTAGCAGGG + Intergenic
1150510949 17:65752539-65752561 CTGGAGAGGTGGAATGAGAAAGG - Intronic
1151548481 17:74807634-74807656 TTTGGGGGGCAGAAGTAGAAGGG + Intronic
1151823330 17:76509100-76509122 TGGGAGAGGGAGGATTAGGAAGG + Intergenic
1153153900 18:2127450-2127472 TTGGAAAGGAAGACTGAGAAGGG - Intergenic
1153540678 18:6150911-6150933 TTGGAAAGTTAGAATTTGAATGG - Intronic
1154059990 18:11050746-11050768 TTGGAGAGGCAGAATTAGAAAGG - Intronic
1154452856 18:14492216-14492238 TTGTAGAGACAGAAATAGAATGG + Intergenic
1155246392 18:23914277-23914299 TTGGAGAGACAGAATAAACAAGG - Intronic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1157344598 18:46814260-46814282 TTGGTGAGTCAGTAGTAGAAGGG - Intronic
1157937815 18:51892628-51892650 TTGGTGAGGGAGAATCAGAAGGG + Intergenic
1158157136 18:54438720-54438742 ATGCAAAGGCAGAAGTAGAAAGG - Intergenic
1159064340 18:63553221-63553243 GTGTAGTGCCAGAATTAGAATGG + Intergenic
1159115221 18:64105908-64105930 ATGGAGAGATATAATTAGAAAGG + Intergenic
1159952182 18:74492714-74492736 TTGGAGCTGGAGAATTAGATTGG + Intergenic
1162212431 19:9103050-9103072 TTGGAGAGGAAGAAGTACATGGG + Exonic
1162222036 19:9185953-9185975 TTGGAGAGGAAGAAGTACATGGG - Exonic
1162223993 19:9204476-9204498 TTGGAGAGGAAGAAGTACATGGG - Intergenic
1162225121 19:9214644-9214666 TTGGAGAGGAAGAAGTACATGGG + Exonic
1162227418 19:9235315-9235337 TTGGAGAGGAAGAATTACATGGG - Intergenic
1162229163 19:9251269-9251291 TTGGAGAGGAAGAAGTACATGGG - Exonic
1162230983 19:9266122-9266144 TTGGAGAGGAAGAAGTACATGGG + Intergenic
1163066457 19:14799943-14799965 TTGGAGAGGAAGAAGTACATGGG + Exonic
1163069595 19:14828048-14828070 TTGGAGAGGAAGAAGTACATGGG + Exonic
1163071040 19:14841684-14841706 TTGGAGAGGAAGAAGTACATGGG + Exonic
1163072143 19:14852751-14852773 TTGGAGAGGAAGAAGTACATGGG + Intergenic
1163074903 19:14881162-14881184 TTGGAGAGGAAGAAGTACATGGG + Exonic
1163076036 19:14892611-14892633 TTGGAGAGGAAGAAGTACATGGG + Intergenic
1163078310 19:14916586-14916608 TTGGAGAGGAAGAAGTACATGGG - Intergenic
1163080934 19:14941660-14941682 TTGGAGAGGAAGAAGTACATGGG - Exonic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166572888 19:43810202-43810224 TTGGAGAGGAAAAAGTAAAATGG - Intronic
1167233885 19:48302349-48302371 TTGGAGAGACAGACGTTGAATGG + Intronic
1167406134 19:49309982-49310004 ATGGAGAAGTAGAAGTAGAAGGG - Intronic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1168608700 19:57781091-57781113 TTGGAGAGAAAGAAATAGTATGG - Intronic
925870357 2:8264922-8264944 TAGGAAAGGCAGAAATAAAAGGG - Intergenic
926198411 2:10777094-10777116 TTGCAGAGACAGAATGGGAAAGG + Intronic
926788372 2:16543291-16543313 TAGGAGAGGAAGATTAAGAAGGG + Intergenic
927407131 2:22783647-22783669 GTGAAGAAGCAGAATTTGAATGG - Intergenic
930336254 2:50050346-50050368 TTGGTCAGGCAGAATTAAATTGG - Intronic
930551836 2:52845229-52845251 TTGGAAAGGAAGAAATAAAATGG - Intergenic
930943060 2:57036619-57036641 TTGGTGAGGCAGAATAGAAAGGG - Intergenic
931653758 2:64491394-64491416 TGGGAAAAGCAGAATTAGAAAGG + Intergenic
931909530 2:66883253-66883275 TTGGAGGGGAAGAATGAGAGGGG - Intergenic
932351709 2:71037903-71037925 TTGGAGAGGAAGAAGTACATGGG - Intergenic
932354201 2:71055363-71055385 TTGGAGAGGAAGAAGTACATGGG - Intergenic
933299239 2:80523947-80523969 TAGGATAGGCAGAGGTAGAAGGG + Intronic
934101976 2:88661746-88661768 TTTAATAGGCAGAATTAGAAAGG - Intergenic
934715020 2:96538105-96538127 TTGGTGTGGCAGAGGTAGAAAGG + Intronic
936007431 2:108902940-108902962 TTGGAAAGGAAGAAATAAAACGG + Intronic
937436426 2:121885547-121885569 TTGGAGAGGAGGAAAGAGAAAGG - Intergenic
938690153 2:133780501-133780523 TAGGAGAGGCAGACTTAATAGGG - Intergenic
939106173 2:137951166-137951188 TTGGAGACTCAGAAGTGGAAGGG - Intergenic
939760736 2:146174685-146174707 TTGGGGAAGCAGAATTTAAAAGG - Intergenic
939896550 2:147798713-147798735 TTAGAGTGGCAGAATTAGCCAGG + Intergenic
940098343 2:150004442-150004464 TAGGACAGGCAGAATTTGAGAGG - Intergenic
940392487 2:153148625-153148647 AAGGAAAGGCAAAATTAGAAAGG + Intergenic
940810486 2:158237384-158237406 TTGGAGAGGCAGAGTGGAAATGG + Intronic
940870232 2:158853782-158853804 TTGGAGAGGAAGAAGTACACGGG - Intronic
940871271 2:158862512-158862534 TTGGAGAGGAAGAAGTACATGGG - Intronic
940872944 2:158874879-158874901 TTGGAGAGGAAGAAGTACATGGG - Intergenic
941266919 2:163373773-163373795 TAGAAGAGGAAGAATCAGAAAGG + Intergenic
941950661 2:171152456-171152478 ATTGAGAGGCAGGATTTGAATGG - Intronic
942617665 2:177810868-177810890 TTGGAAAGGCAGAAATAGATGGG + Intronic
943559088 2:189440084-189440106 TTGGGGAGCCAGAACTAGAAAGG - Intergenic
943754924 2:191547873-191547895 TCTGAGAGACAGAATTTGAAAGG - Intergenic
943755760 2:191555304-191555326 TGGGAGAGGCTGAACTAGGATGG + Intergenic
944356941 2:198801502-198801524 TGGGAAAAGCAGAATTATAAAGG - Intergenic
944496672 2:200314093-200314115 CTGGAGATGCAGATTTACAATGG - Intronic
945621627 2:212146799-212146821 TTGGAAAGGCAGTAGCAGAATGG + Intronic
946658579 2:221975666-221975688 TTGGAGAGGAAAATTGAGAATGG - Intergenic
947762890 2:232616639-232616661 TCAGAGAGACAGAAGTAGAATGG + Intronic
948742278 2:240055808-240055830 TGGGGCAGGCAGAATTGGAAAGG + Intergenic
1169718636 20:8647874-8647896 TTGGAGAAGCAGAAAAACAAGGG - Intronic
1170241055 20:14166759-14166781 TGGGAGAGGAACAATGAGAAGGG - Intronic
1170735101 20:19007514-19007536 TTGGGAAGGGAGAATTGGAAAGG + Intergenic
1172285313 20:33736253-33736275 TTGCAGAGGCAGTTTCAGAATGG - Intronic
1173779058 20:45738230-45738252 TCATAGAAGCAGAATTAGAATGG + Intergenic
1174773218 20:53320780-53320802 TGGGAGAGACTGAAGTAGAAGGG + Intronic
1176036442 20:63040450-63040472 TTGGAAAGGAAGAACTAAAATGG - Intergenic
1177003575 21:15643197-15643219 TAGGAGAGTCAGAGTCAGAAGGG - Intergenic
1177006403 21:15677701-15677723 TTGTAGAGGTAGAATTTCAAAGG + Intergenic
1177608303 21:23411110-23411132 TTTGAGAGCCAGAATTATAAAGG + Intergenic
1178254780 21:31042150-31042172 TTGGAGAGGCCAAGTTAGGAAGG - Intergenic
1178282365 21:31294398-31294420 GTGGAGAAGCAGAGTTAGAAAGG - Intronic
1179298194 21:40081902-40081924 TGGGAGAGGTAGAACAAGAAGGG - Intronic
1179565405 21:42244816-42244838 TGGGAGAGGCACACTTACAAAGG + Intronic
949441490 3:4085893-4085915 TTTGAGAGGCAGAAGAGGAAAGG - Intronic
949885313 3:8688363-8688385 TTGGAGAGGAAGAAGTACATGGG - Intronic
950584793 3:13884405-13884427 AAGGAGAGGCAGAACTAAAAAGG + Intergenic
952291118 3:32016746-32016768 TTTGGGAGGCAGAATTAAAATGG + Intronic
952923963 3:38307924-38307946 TTGGACAGGCAGAAGTGGAAGGG + Intronic
954582164 3:51708764-51708786 GTGGGGAGGCAGAGTCAGAAGGG + Intronic
956028115 3:65005720-65005742 CTGCAGAGGCACAATTTGAATGG - Intergenic
956611673 3:71130083-71130105 CTGTAGATGCAGAATTACAAAGG + Intronic
957042691 3:75348564-75348586 TTGGAGAGGAAGAAGTACATGGG + Intergenic
957045528 3:75371164-75371186 TTGGAGAGGAAGAAGTACATGGG + Intergenic
957684523 3:83483934-83483956 CTAGAGAGGAAGAATTAGAATGG - Intergenic
957856661 3:85887755-85887777 TCCTAGAGGCAGAATTAGAATGG - Intronic
958784385 3:98581672-98581694 CTGGACAGGCAGAAATAAAAGGG + Intronic
958824458 3:99013726-99013748 TTGGAGAGGAATAACTAGAAAGG - Intergenic
959365312 3:105450954-105450976 ATGTAGAGGGAGAATTAGGATGG + Intronic
959958022 3:112261505-112261527 TAGTAGAGACAGAATTAAAAAGG + Intronic
959981718 3:112524959-112524981 TTGGAGAGGAAGAAGTACATGGG + Intergenic
960319451 3:116216745-116216767 TTGGAAAGGTAGTATTAAAAAGG + Intronic
961099764 3:124188603-124188625 TTGGATAGGGAGAATGAGAGGGG + Intronic
961272981 3:125703546-125703568 TTGGAGAGGAAGAAGTACATGGG - Intergenic
961273977 3:125712307-125712329 TTGGAGAGGAAGAAGTACATGGG - Intergenic
961276856 3:125734464-125734486 TTGGAGAGGAAGAAGTACATGGG - Intergenic
961875754 3:130022325-130022347 TTGGAGAGGAAGAAGTATATGGG + Intergenic
961877567 3:130035292-130035314 TTGGAGAGGAAGAAGTACATGGG + Intergenic
963311572 3:143715686-143715708 GGGGAGAGGAAGAATTAGAGAGG + Intronic
963641601 3:147867164-147867186 TTAGGGAGGCAGATTAAGAAGGG - Intergenic
964182895 3:153908910-153908932 TTGGGGAGGCAGGATTGAAAAGG - Intergenic
964481565 3:157143685-157143707 TTAGAGAGGCTTACTTAGAAGGG + Intergenic
965219927 3:165915900-165915922 TTGCAGAGGAAAAATTTGAAAGG + Intergenic
965909373 3:173752800-173752822 TTTGAGAGGGAGAAGTAGACTGG - Intronic
966265142 3:178031359-178031381 TTGGAGAGGTAGGATAAGGAAGG - Intergenic
966446907 3:180010562-180010584 CTGGAGAGGCATAATTACAGGGG + Intronic
966474834 3:180332094-180332116 TGGCAGAGGCAGAATAAGAAAGG - Intergenic
966666104 3:182472639-182472661 TTGGTGAGGAAGAATTTGTAAGG - Intergenic
968988111 4:3890071-3890093 TTGGAGAGGAAGAAGTACATGGG + Intergenic
968989804 4:3902341-3902363 TTGGAGAGGAAGAAGTACATGGG + Intergenic
969019107 4:4127374-4127396 TTGGAGAGGAAGAAGTACATGGG + Intergenic
969023742 4:4157247-4157269 TTGGAGAGGAAGAAGTACATGGG + Intergenic
969730076 4:8949823-8949845 TTGGAGAGGAAGAAGTACATGGG - Intergenic
969786241 4:9459453-9459475 TTGGAGAGGAAGAAGTACATGGG - Intergenic
969787327 4:9469200-9469222 TTGGAGAGGAAGAAGTACATGGG - Intergenic
969789680 4:9483937-9483959 TTGGAGAGGAAGAAGTACATGGG - Intergenic
969794156 4:9513103-9513125 TTGGAGAGGAAGAAGTACATGGG - Intergenic
970017298 4:11526256-11526278 TTGGAGAGTAAGAATAAGAAGGG + Intergenic
971342448 4:25782948-25782970 TGGGAGAAGCAGAAGCAGAAGGG + Intronic
972300980 4:37785390-37785412 TAGGAGAGGAAGAATTAGCAGGG + Intergenic
973749292 4:53997336-53997358 ATGTAGCTGCAGAATTAGAAAGG + Intronic
973936483 4:55851742-55851764 ATGGTGAGGGAAAATTAGAATGG + Intergenic
974516006 4:62911893-62911915 TTGGAGAGCAAGAGTCAGAAAGG - Intergenic
975183134 4:71369967-71369989 TGGGAGTGGCAGTAATAGAAAGG + Intronic
975273539 4:72466908-72466930 TTGAGGAGGCAGATTTAGAGAGG - Intronic
976756260 4:88501194-88501216 TTGGACAGGAGGAAATAGAAAGG - Intronic
976920021 4:90428235-90428257 TTGGAGAGGGAAAAAGAGAAAGG - Intronic
977902622 4:102439551-102439573 GTGGAGAGGCAGAAAAGGAAGGG + Intergenic
979740676 4:124146751-124146773 ATGGAAAGGCAGAATCACAAAGG + Intergenic
980034692 4:127870521-127870543 GTTGAGAGGCAGAACAAGAATGG - Intergenic
981135363 4:141205436-141205458 TTGGAAAGGCAAAATTAGAGAGG + Intronic
981301606 4:143192889-143192911 ATGGAAAGGCAGAAATGGAAAGG + Intronic
983331689 4:166337806-166337828 TTGGAGAGCCAATATTAGAGAGG + Intergenic
984036298 4:174672377-174672399 TTGGAGAGGAAGAAAGAAAAAGG - Intronic
984052136 4:174877452-174877474 TTGAAGAGGCAGTATCAGAGAGG + Intronic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
985347648 4:189023526-189023548 TTGAAGAGGAAGAATAAAAACGG + Intergenic
985985596 5:3513461-3513483 CGGGAGAGGCAGAAGGAGAAGGG + Intergenic
987854935 5:23408885-23408907 TTGCGGAGGAAGAATAAGAAAGG - Intergenic
988707846 5:33743154-33743176 CTGGAGAGGCAGAAAAGGAAGGG + Intronic
990778595 5:59332470-59332492 TTGGAAAGGGTGAATTAGAGTGG - Intronic
990790305 5:59470259-59470281 TTGGTGAGGCAGAATTAAATAGG - Intronic
990971414 5:61510598-61510620 TGGAATAGGCAGTATTAGAAAGG + Intronic
991635575 5:68701475-68701497 TATGAGAGCCAGAATTAGACTGG + Intergenic
991958781 5:72021298-72021320 TTGGGCAGGCAGAGTGAGAAGGG + Intergenic
993064419 5:83080096-83080118 CTGGAGAGGAGGAATTATAATGG + Intronic
993710529 5:91220303-91220325 ATGGAGAAAGAGAATTAGAAAGG + Intergenic
994123844 5:96148220-96148242 TTTGAGAGACAAAATTAAAATGG - Intergenic
994608409 5:102001899-102001921 TTGGAAAGGAAGAAGTAAAATGG + Intergenic
994612363 5:102059383-102059405 GTGGAGAGGAAGAATAACAAGGG + Intergenic
995573339 5:113504167-113504189 TTTGAGAGGCTGAAGTGGAAGGG - Intergenic
995886526 5:116900816-116900838 TTTGAGAGGCACTACTAGAAAGG - Intergenic
995962574 5:117860845-117860867 TAGGAGTAGGAGAATTAGAATGG + Intergenic
996598176 5:125229013-125229035 ATGGAGAGGCAGAAATATAATGG + Intergenic
996698019 5:126420437-126420459 CTAGAGTGGAAGAATTAGAAAGG - Intronic
996742678 5:126815721-126815743 TTTCAATGGCAGAATTAGAAAGG + Intronic
997047584 5:130337410-130337432 TTGGAAAGGCAGACTGGGAAAGG + Intergenic
997376884 5:133403745-133403767 CTGGAGAAGCAGAGTTGGAAGGG + Intronic
997492307 5:134287746-134287768 TTTCAAAGGCAAAATTAGAAGGG - Intronic
998179827 5:139928879-139928901 TTGGGCAGGCAGAATTAGCCAGG - Intronic
998188600 5:140002420-140002442 TTGAAAAGGCAGAATTTGAAGGG + Intronic
1000000455 5:157133866-157133888 TTCCAGAGGCTGAAGTAGAAGGG - Intronic
1000039467 5:157474347-157474369 TTGGAGAAGAACCATTAGAAAGG + Exonic
1000208331 5:159084229-159084251 TTCAAGTGGGAGAATTAGAAAGG + Intronic
1000996828 5:167967923-167967945 TCAGGGAGCCAGAATTAGAAAGG - Intronic
1001066270 5:168537292-168537314 TGGGAAAGGCAGATTTAGGATGG + Intergenic
1003488110 6:6597039-6597061 TTGGAGAGGTAGAAATGGGAAGG + Intronic
1004647635 6:17577977-17577999 TTGGAAGGTCAGAAATAGAAGGG - Intergenic
1004750265 6:18555239-18555261 ATGGAAAGGCAGAATGACAAAGG + Intergenic
1005203869 6:23378739-23378761 TAGGTGAGGAAGAAGTAGAAGGG - Intergenic
1005665275 6:28046605-28046627 TTGGAGAGGAAGAAATACATAGG - Intergenic
1007472293 6:42098821-42098843 TTGGAGAGGCTGGATTTGAGTGG + Intergenic
1007616335 6:43181899-43181921 TGGGAGAGGGAGGATTAGGAGGG + Intergenic
1008793349 6:55267849-55267871 TTGCAGGGGCAGAATCAGGAAGG + Intronic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010870501 6:81031405-81031427 AGGGAGTGGCAGAATTAGAGGGG + Intergenic
1011160832 6:84388640-84388662 TTGGAGAGGATGAATTAGGAGGG + Intergenic
1011347256 6:86384680-86384702 TGGGAGAGTCAAGATTAGAAAGG + Intergenic
1011669793 6:89672228-89672250 TTGGAGAGGCTGAAATCGTACGG - Exonic
1011954347 6:93007185-93007207 TAGGAAAGGAAGAATTTGAAAGG - Intergenic
1011988723 6:93484328-93484350 TTGAAGTGGCAGATTTTGAAAGG + Intergenic
1012262517 6:97104027-97104049 TTGGAAAGCCAGTATTAAAAGGG - Intronic
1013632888 6:112002064-112002086 TTGGAGAGGCAGACCGAGAATGG + Intergenic
1014764740 6:125393444-125393466 CAGGGGAGGCAGAATTAGATTGG - Intergenic
1016064280 6:139662854-139662876 CTTGAGACACAGAATTAGAAGGG + Intergenic
1016092300 6:139994498-139994520 TTTGAGAGGCAGAAAGAGAATGG + Intergenic
1016641374 6:146353245-146353267 TAGGAAAGGCATAATCAGAATGG + Intronic
1017098232 6:150824204-150824226 TAGGAGAGGGAGAATAAGAATGG + Intronic
1017298082 6:152822424-152822446 TTGATGAGGCAAAATTAAAAAGG + Intergenic
1017737241 6:157376316-157376338 TTGGACAGGAAGAATATGAAAGG - Intergenic
1019725684 7:2601239-2601261 AGTGAGAGGCAGAATTAGGATGG - Intronic
1020306030 7:6835562-6835584 TTGGAGAGGAAGAAGTACACGGG + Intergenic
1020312624 7:6880381-6880403 TTGGAGAGGAAGAAGTACATGGG + Intergenic
1020542538 7:9477194-9477216 ATGGGAAGGCAGACTTAGAAAGG - Intergenic
1020831123 7:13096738-13096760 CTTGAGAGGCAGAAGAAGAAAGG + Intergenic
1020837380 7:13170047-13170069 TTGGAGAGGTAGAGACAGAAAGG - Intergenic
1021085121 7:16413476-16413498 TTAGAGATTCAGAATGAGAAAGG - Intronic
1021432672 7:20578723-20578745 TGGGAGAAGCTGAATGAGAAAGG - Intergenic
1022364211 7:29695047-29695069 TTTTAGAGGCAGACATAGAATGG - Intergenic
1022431837 7:30331623-30331645 GTGGAGAGGCAGTATTTGAAGGG + Intronic
1023171461 7:37393829-37393851 AAGGAGAGGCTGAACTAGAAGGG + Intronic
1023773008 7:43576239-43576261 TTGGAAAGGAAGAATTTAAATGG - Intergenic
1023777089 7:43618059-43618081 ATGGAGGGGCAGAATATGAATGG + Intronic
1024773996 7:52760984-52761006 TTAGAGAAGCAGAATTTGAAAGG + Intergenic
1024809054 7:53185415-53185437 TGTGAGTGGCAGAATTACAATGG - Intergenic
1027364587 7:77444280-77444302 TTTGAGAGGCAGCATTCCAATGG + Intergenic
1028443913 7:90896319-90896341 TTGAAGAGAGAGAATGAGAAAGG - Intronic
1028966201 7:96804461-96804483 CCTGAAAGGCAGAATTAGAAGGG - Intergenic
1029080166 7:97966830-97966852 TTGGAGAGGAAGAAGTACATGGG + Intergenic
1030804692 7:113901317-113901339 TTGGAGAGTCCAATTTAGAAGGG - Intronic
1032608628 7:133387061-133387083 TTTGGGATGCACAATTAGAATGG + Intronic
1032950709 7:136907907-136907929 TTGGAAAGGCAGAATGATACTGG - Intronic
1033649875 7:143332700-143332722 TGGGAGAGGAAGAAGCAGAAAGG - Intronic
1033741230 7:144277238-144277260 TTGGAAGGGCAGAATCAGAAAGG + Intergenic
1033752673 7:144372376-144372398 TTGGAAGGGCAGAATCAGAAAGG - Exonic
1033966698 7:146984034-146984056 ATGGAGAGGAAGAACAAGAAGGG - Intronic
1034524360 7:151647549-151647571 GTGCAGAGGCAGATTTTGAAGGG + Intronic
1034635498 7:152564137-152564159 TTGGAGTGTCAGAATTAAACGGG - Intergenic
1035083392 7:156236048-156236070 TTGGAGACGCTGAAATGGAAGGG + Intergenic
1035339452 7:158151134-158151156 AGGGAGAGGCAGGAATAGAAAGG - Intronic
1035339479 7:158151244-158151266 AGGGAGAGGCAGGAATAGAAAGG - Intronic
1035339519 7:158151391-158151413 AGGGAGAGGCAGGAATAGAAAGG - Intronic
1035339529 7:158151428-158151450 AGGGAGAGGCAGGAATAGAAAGG - Intronic
1035339539 7:158151465-158151487 AGGGAGAGGCAGGAATAGAAAGG - Intronic
1036223456 8:6939758-6939780 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036236327 8:7042501-7042523 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036261820 8:7247387-7247409 TTGGAGAGGAAGAAGTACATGGG + Intergenic
1036304773 8:7592165-7592187 TTGGAGAGGAAGAAGTACATGGG - Intergenic
1036313860 8:7705932-7705954 TTGGAGAGGAAGAAGTACATGGG + Intergenic
1036355622 8:8040157-8040179 TTGGAGAGGAAGAAGTACATGGG - Intergenic
1036818563 8:11920564-11920586 TTGGAGAGGAAGAAGTACATGGG + Intergenic
1036819550 8:11929337-11929359 TTGGAGAGGAAGAAGTACACGGG + Intergenic
1036832719 8:12034386-12034408 TTGGAGAGGAAGAATTACGTGGG + Intergenic
1036902894 8:12684909-12684931 TTGGAGAGGAAGAAGTACATGGG + Intergenic
1039174864 8:34792420-34792442 TTGGAGAAGCAGAGATAGCATGG - Intergenic
1039183975 8:34895858-34895880 TTGGAGAGGGGGATTTAGCAGGG - Intergenic
1039550494 8:38439712-38439734 TTGGAGAGAGAGAAGGAGAAAGG - Intronic
1040293470 8:46137249-46137271 TTGGAGAGGCCAAATTTGGAGGG + Intergenic
1040405186 8:47094743-47094765 TTGGAGACTCAGAAGAAGAAAGG + Intergenic
1040570460 8:48604881-48604903 CTGGAGAAACAGAATTAGAGTGG - Intergenic
1041340354 8:56839498-56839520 TTGGAGAGGAAGAAATGAAACGG - Intergenic
1042746138 8:72108460-72108482 TTAGAAAGACAGAATGAGAAGGG + Intronic
1044113213 8:88302647-88302669 TTGGAAATGCAGAAGTGGAAGGG + Intronic
1045290008 8:100824990-100825012 TCAAAGAGGCAGAAATAGAATGG - Intergenic
1045384505 8:101658340-101658362 TGGCAGAGACAGAATTTGAAAGG - Intronic
1045835073 8:106510533-106510555 CTGAAGAGGCAGAATTAGTTTGG + Intronic
1046155030 8:110277276-110277298 TTGGAGAGGCAGAGGTAAAATGG + Intergenic
1046327445 8:112668536-112668558 TGAGGGAGGCAGAGTTAGAAGGG + Intronic
1046349225 8:112984668-112984690 TTGGAAAGACAGAAATAAAATGG + Intronic
1046918088 8:119698875-119698897 ATGGAGAGACAGAAACAGAAGGG - Intergenic
1047197772 8:122736938-122736960 TTGGAGAGGCAGAGAGAGTAAGG + Intergenic
1048261067 8:132945431-132945453 TGGGAGAGGGAGATTTAGGAAGG + Intronic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1048804245 8:138224870-138224892 TTGTAGAAACAGAAATAGAAAGG + Intronic
1048963920 8:139601477-139601499 TGGCAGAGGTTGAATTAGAATGG - Intronic
1050313632 9:4378703-4378725 ATCCAGAGGCAGAATGAGAAAGG + Intergenic
1051427766 9:16951037-16951059 TTGGAAAGAAAGAATCAGAATGG - Intergenic
1052955442 9:34250201-34250223 TTGGAGAGGCAGAGAAAGGAGGG - Intronic
1053468438 9:38327148-38327170 TGGGAGAGGCACCATTAGAAGGG - Intergenic
1055844673 9:80546842-80546864 GTGGAAAGGCAGAATAGGAATGG + Intergenic
1056748037 9:89321772-89321794 TTGAAGAGGAAGAGTTAGAAAGG + Intronic
1056864326 9:90216196-90216218 TTGGAGAGGAAGAAGTACATGGG - Intergenic
1056866573 9:90232326-90232348 TTGGAGAGGAAGAAGTACATGGG - Intergenic
1056915575 9:90743244-90743266 TTGGAGAGGAAGAAGTACATGGG + Intergenic
1056916585 9:90751990-90752012 TTGGAGAGGAAGAAGTACATGGG + Intergenic
1058513390 9:105743950-105743972 TTGGAGAGTCAGAATATGTATGG + Intronic
1059668525 9:116472169-116472191 TTGGAGAGGCAGGACTTGCAAGG - Intronic
1059954157 9:119498576-119498598 ATAGAGAGGCAGTACTAGAAGGG + Intronic
1062137586 9:134937973-134937995 TTGGAGAGGCAGAGGGGGAAAGG - Intergenic
1185942695 X:4339133-4339155 TTGGAGAGGCAGATTGAATATGG + Intergenic
1186278971 X:7972343-7972365 TTTCAGGGGCAGAATTGGAATGG - Intergenic
1188206828 X:27370206-27370228 TTGGAGACTCAGAAACAGAAGGG + Intergenic
1188404967 X:29796786-29796808 TTGGAGATGCAGGATTTGCAGGG - Intronic
1188538835 X:31227045-31227067 GTGGAGAAGGAGGATTAGAAAGG - Intronic
1188811099 X:34655866-34655888 TTGAAGAATCAAAATTAGAAAGG + Intronic
1189234400 X:39476415-39476437 CTGGAGAGGAAGAAAAAGAAGGG + Intergenic
1189315368 X:40052280-40052302 TTGCAGAGGCAGAATTTTATCGG - Exonic
1189710555 X:43807255-43807277 TAGGAGAGGCAGAGCTAGAATGG - Intronic
1191896420 X:65998098-65998120 TTGGGGAGGCAGTATGGGAATGG + Intergenic
1193287033 X:79725184-79725206 TTTGAGTGGGAGAATTAAAAAGG + Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1195252244 X:103060477-103060499 TTGGAGAGGCACATATAGCAAGG - Intergenic
1197536836 X:127700330-127700352 TTGGAGTGGAAGAAATGGAAAGG - Intergenic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1198180776 X:134206426-134206448 GTGGAGAGGTTGAATTAGATAGG + Intergenic
1198757405 X:139995856-139995878 AGGGAGAGGTAGATTTAGAATGG + Intergenic
1199480326 X:148291454-148291476 TTGGAGAGGCAGGTGTAGGAAGG - Intergenic
1199780313 X:151052224-151052246 TTGGAGTGCCAGAATGAAAAGGG + Intergenic
1199915361 X:152334394-152334416 TTGCACAGGAAGAATTAAAATGG + Intronic
1201666782 Y:16466499-16466521 TTGTAGAGGTAGACTTGGAAGGG - Intergenic