ID: 1154065721

View in Genome Browser
Species Human (GRCh38)
Location 18:11105143-11105165
Sequence CCCAGGCCTTGCCATGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154065709_1154065721 28 Left 1154065709 18:11105092-11105114 CCACAGAAGAAAACATAGCCAAG 0: 1
1: 0
2: 8
3: 379
4: 9736
Right 1154065721 18:11105143-11105165 CCCAGGCCTTGCCATGATGGAGG 0: 1
1: 0
2: 4
3: 29
4: 225
1154065714_1154065721 10 Left 1154065714 18:11105110-11105132 CCAAGAAATGGAGAAGGGGAGTG 0: 1
1: 0
2: 4
3: 37
4: 357
Right 1154065721 18:11105143-11105165 CCCAGGCCTTGCCATGATGGAGG 0: 1
1: 0
2: 4
3: 29
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154065721 Original CRISPR CCCAGGCCTTGCCATGATGG AGG Intronic
900359699 1:2282662-2282684 CCCAGGCCCTATCATGAGGGTGG - Intronic
900378062 1:2368481-2368503 CCCAGGTGTTGCCATGGTGATGG + Intronic
900403508 1:2482588-2482610 CCCACGGCTTGGCATGAAGGTGG - Intronic
900558554 1:3292100-3292122 CACAGGCCTTGGCAGGATGCTGG + Intronic
900733341 1:4277779-4277801 CACAGGCTTTGCCATCCTGGGGG + Intergenic
901853683 1:12031140-12031162 CACAGGCCCTGCCTTGGTGGGGG + Intronic
903690744 1:25171660-25171682 CCCAGGTCCTGCCCTCATGGAGG - Intergenic
904886093 1:33739444-33739466 CCAAGAACTTGCCATGTTGGCGG + Intronic
905227380 1:36488112-36488134 CCCAGGCCTGGGAATGACGGTGG + Intergenic
905481446 1:38264729-38264751 CCCAGGCCTAGTGATGATGGGGG + Intergenic
905914729 1:41676748-41676770 CCCTGCCCTGGCCAGGATGGTGG - Intronic
905922818 1:41730512-41730534 GCCAGGCCTGGCAATGCTGGGGG + Intronic
906580348 1:46930566-46930588 CCCTGGCCTTGTCTTGATAGAGG - Intronic
906749339 1:48245109-48245131 CCCAGTCTTTGCAATGATGATGG - Intronic
907421684 1:54352004-54352026 ACCAGGCCTGGCCAAGATCGGGG - Intronic
909280851 1:73751212-73751234 CATAGGCTTTTCCATGATGGTGG - Intergenic
911471089 1:98318969-98318991 CCCAAGTCTTGCAATGGTGGTGG - Intergenic
911948605 1:104142694-104142716 CCCAGGCTTTGCCCTCATGTTGG + Intergenic
912414275 1:109497595-109497617 GTCAGGCCTTGCCATGATCTAGG - Intronic
912449836 1:109761951-109761973 TCCAGGCCCAGCCAGGATGGAGG - Intronic
915312790 1:155012702-155012724 CCCTGGCCTTGCAATGAAGAGGG + Intronic
915554962 1:156656293-156656315 CCCAGCCCCTGCCACAATGGTGG + Exonic
916473219 1:165143675-165143697 CCCAGCCCTTGCCCTGAGTGGGG + Intergenic
917791660 1:178503012-178503034 CCCAGGCCATGCCCCGATGCAGG - Intergenic
919769237 1:201146728-201146750 CCCTGGCGTTACCTTGATGGTGG + Exonic
920421928 1:205840743-205840765 CCCGTGCTATGCCATGATGGGGG - Intronic
920422675 1:205845791-205845813 CCCAAGCCTGGCCTTAATGGTGG - Intronic
920732717 1:208503093-208503115 CCCAGGCCTTGACATAATGAAGG + Intergenic
921069045 1:211643633-211643655 CCTAGGCCTTGGCATTATGCGGG + Intergenic
924774666 1:247107686-247107708 CCCAGGTCTTGCTATAATTGTGG + Intergenic
1062985632 10:1766060-1766082 CCCAGGGCTGGCCATGCAGGAGG - Intergenic
1064821442 10:19339155-19339177 CCAAGGCCATGCCTTCATGGTGG + Intronic
1065305716 10:24366633-24366655 CCCATGCTTTGCCATGCAGGAGG - Intronic
1066647279 10:37622580-37622602 CCCAGCCCTTGCTGTGGTGGTGG + Intergenic
1067083696 10:43227370-43227392 TCCAGGCCTGGCCAGGATGCAGG - Intronic
1067879297 10:50029766-50029788 CTCAGGCTTGGCCATGATGCTGG - Intergenic
1069649956 10:70039241-70039263 CCCAGGCCATGTAATGCTGGAGG - Intergenic
1071032885 10:81205771-81205793 CACTGTCCTTTCCATGATGGAGG - Intergenic
1071946958 10:90656677-90656699 CACAGCCCTTTCTATGATGGAGG + Intergenic
1073459828 10:103660215-103660237 CCCAGCCCTGGCCCTGTTGGGGG + Intronic
1074526774 10:114269612-114269634 CCCAAGCCTTCCCCTGAAGGTGG + Intronic
1076440601 10:130478967-130478989 CCCAGGCCTCGCCTTGAACGAGG - Intergenic
1077099577 11:816144-816166 CCCAGCCCTTGCCAGGATTCTGG + Intergenic
1077232913 11:1466359-1466381 CCCAGGCCTTGCTGGGACGGAGG - Intergenic
1078430041 11:11281505-11281527 CCCAGGCCTTGCCAACAGCGAGG + Intronic
1078600391 11:12725030-12725052 CCCAGGCCTGGGCTTGGTGGTGG + Intronic
1079701784 11:23556823-23556845 TGCAAGCCTTGCCATGATGATGG - Intergenic
1081431305 11:42979355-42979377 CGGAGGCCTTACCATCATGGTGG - Intergenic
1081804658 11:45883960-45883982 CCCAGGTCTTGGTATGAGGGAGG - Intergenic
1083325115 11:61869242-61869264 CCTAGGCCTTGCCCTCCTGGTGG + Intergenic
1084519838 11:69656388-69656410 CCCTGGCTGTGCCACGATGGGGG + Intronic
1084519853 11:69656429-69656451 CCCTGGCTGTGCCACGATGGGGG + Intronic
1085393265 11:76193384-76193406 AGCTGGCCTGGCCATGATGGTGG + Intronic
1088746654 11:112809674-112809696 CCCAGGCCTGGCCATAAAGCTGG - Intergenic
1089494795 11:118902599-118902621 CCCCGGCCCTGCCCTGCTGGGGG - Exonic
1091229376 11:133977805-133977827 CCCAGGGCTGGCCCTGAGGGTGG - Intergenic
1091782592 12:3223325-3223347 CCCAGGGCTGGCCATGCTGGAGG - Intronic
1092067783 12:5606114-5606136 GCCAGGCCTAGCAATGATGGGGG + Intronic
1092269514 12:7012141-7012163 CCTAGTCTTGGCCATGATGGTGG - Intronic
1098290568 12:68953635-68953657 CTCAGTCCCTGCCCTGATGGTGG + Intronic
1100097519 12:91059879-91059901 CTCAGGAGTTACCATGATGGAGG - Intergenic
1100829365 12:98503826-98503848 CGCAGGCCTTCGCAAGATGGCGG - Exonic
1101498050 12:105274704-105274726 CCCAGGACTTGGAATGTTGGAGG - Intronic
1102568957 12:113815691-113815713 ACCAGGCATGGCCATGATGCTGG - Intergenic
1103436071 12:120926240-120926262 CCCAGGCCTCGCCTTGTTGGGGG - Intergenic
1104359207 12:128116209-128116231 ACCAGGCCTTGTCAGGAGGGAGG - Intergenic
1104954956 12:132459825-132459847 CCCTGGCCTTGCCACCATGCCGG + Intergenic
1105003609 12:132707274-132707296 CCCACCCCCTGCCATGATGGAGG + Intergenic
1105798567 13:23881657-23881679 CCCAGGACTTGGCATGGAGGTGG + Intronic
1108221029 13:48233348-48233370 CCCAGGCCGCGCCATGGTGAAGG + Exonic
1112224269 13:97522556-97522578 GGGAGGCCTTGCCATCATGGTGG + Intergenic
1113642407 13:111967215-111967237 CCATGGCCTTCCCAGGATGGTGG - Intergenic
1113931136 13:113969572-113969594 CCCGTGCCTTGCCATGGTGCTGG + Intergenic
1115785944 14:36826307-36826329 CCCAAGCCTTGCCAAGCTGGAGG - Intronic
1116275369 14:42825359-42825381 CAGAGGCCTTGCAATCATGGTGG - Intergenic
1119618286 14:76112800-76112822 CCCAGGCCTTGGGAGGGTGGGGG + Intergenic
1120700079 14:87689768-87689790 GCCAGGCATCGACATGATGGTGG - Intergenic
1121259767 14:92557704-92557726 CCCAGGCCTTGCCAGGCCAGCGG - Intronic
1121812342 14:96902200-96902222 CACAGGCATTGCCAGGATGCTGG - Intronic
1122214626 14:100194654-100194676 CCCAGCCCTTGGCCTGATGCTGG - Intergenic
1122849878 14:104522420-104522442 ACCACGCCTTGCCAGGATGCTGG + Intronic
1123908355 15:24942674-24942696 CACTGGCCCTTCCATGATGGAGG + Intronic
1123947722 15:25246921-25246943 CCCAGGCCGTGCCATGCTGCAGG - Intergenic
1125457971 15:39879943-39879965 CCCAGGCCTTGCCATTATTTAGG + Intronic
1125679442 15:41521823-41521845 CCAAGGCCATACCATGATAGAGG + Exonic
1125760840 15:42094486-42094508 CCCAGCCCTTGCCAAGATGCTGG + Exonic
1125968317 15:43891848-43891870 CCAAAGCCTTGCGTTGATGGTGG - Intronic
1127546780 15:60000025-60000047 GCCAGGCCTTGCGGTGCTGGGGG + Intergenic
1129692859 15:77723678-77723700 CCCAGGCCTGGGCATCCTGGAGG + Intronic
1130653223 15:85774044-85774066 CCCAGGCCCTGCTATGAGGCTGG - Intronic
1131253087 15:90843697-90843719 CCCAGGGCTTGGCATGAAGTAGG + Intergenic
1132852279 16:2030195-2030217 CCCAGGCCTTCCCAGCATGCAGG - Intronic
1132982041 16:2743216-2743238 CCCAGGCCTTCGCAGAATGGAGG + Intergenic
1134068570 16:11246265-11246287 CCCAGGGCTGGGCATGCTGGGGG + Intergenic
1135335705 16:21599586-21599608 CCCAGCCTTTGCCCTGAAGGGGG + Exonic
1135912274 16:26572160-26572182 CCCAGATATTGCCCTGATGGGGG + Intergenic
1137044842 16:35645153-35645175 CCCAGATGTTGCCATGATGATGG - Intergenic
1137686488 16:50390445-50390467 CCCAGGCCTTGCCCAGCTGGGGG + Intergenic
1137854049 16:51775737-51775759 TCCAGGCCTTGCCAGGGTAGGGG - Intergenic
1138125651 16:54436351-54436373 CCCACGCCTTCCTGTGATGGAGG - Intergenic
1138460778 16:57146480-57146502 GCCAGGCCTTGCCCCGGTGGTGG + Intronic
1139329026 16:66173327-66173349 CCCAGCCCTTGCCCTTGTGGAGG + Intergenic
1141703065 16:85651245-85651267 GCCGGGCCTTGCCTGGATGGGGG + Intronic
1142138011 16:88460395-88460417 CCCAGGCAGTGTCATGGTGGCGG + Intronic
1143498733 17:7326898-7326920 CCCAGGCCTTCCCCTGCCGGTGG + Exonic
1144711072 17:17401768-17401790 GCCAGGACTGGCCACGATGGAGG + Intergenic
1147388711 17:40096615-40096637 CAGAGGCCCAGCCATGATGGAGG - Intronic
1147535236 17:41316441-41316463 CCCAGGCCTTTCCTTGACCGGGG + Intergenic
1148104890 17:45113838-45113860 CCCAAGCCTGGCCCTGAGGGTGG - Intronic
1148704999 17:49622335-49622357 CCCAGCCCTGTCCATGGTGGTGG - Intronic
1148735028 17:49860486-49860508 CCCCGCCCTTCCCCTGATGGTGG - Intergenic
1148739758 17:49886166-49886188 CCCAGGGCTTGCTGTGATGCTGG - Intergenic
1149978350 17:61288821-61288843 TCCTGGCCTAGCCAGGATGGTGG + Intronic
1150613407 17:66751143-66751165 CCCAGGCGATGGCAGGATGGAGG + Intronic
1151342931 17:73483190-73483212 CCCAGGCCTTGCCTTGATGCAGG + Intronic
1152605317 17:81286636-81286658 CCCAGCCCCTGCCAGGCTGGAGG + Intronic
1153089862 18:1331191-1331213 CTCTGTCCTTTCCATGATGGAGG - Intergenic
1154065721 18:11105143-11105165 CCCAGGCCTTGCCATGATGGAGG + Intronic
1154201008 18:12300848-12300870 CCCAGGCCTGGCCCAGATGTCGG - Intergenic
1157539066 18:48486402-48486424 GCCAGCCCTGGCCATGATGGAGG + Intergenic
1160577865 18:79867280-79867302 CCCAGGCCTTGTCAGGTTAGTGG - Intronic
1163708670 19:18832539-18832561 CCCAGGCCCGGCCGCGATGGGGG - Intronic
1164371465 19:27647682-27647704 CCCAGGCATTTCCATGGTAGAGG - Intergenic
1164372238 19:27652775-27652797 CCCAGGCTGTCCAATGATGGAGG - Intergenic
1164813723 19:31178203-31178225 CCCAGGGCTTAGCATGCTGGAGG - Intergenic
1164860549 19:31558991-31559013 CCCAGGCTTTTCCATGAAGGTGG + Intergenic
1165825591 19:38703982-38704004 CCCAGGCCCTGCCATCCTGCTGG - Intronic
1166072149 19:40393989-40394011 TCCAGGCCCGGCCAGGATGGAGG - Exonic
1167303814 19:48695795-48695817 CCCAAGCCTGGCCATAAGGGTGG - Intergenic
1167420724 19:49401417-49401439 CCCAGGCCTTGACAGACTGGAGG + Intronic
1168401266 19:56087405-56087427 CCCAGGCCTGGGCGTGGTGGAGG - Exonic
925259522 2:2517602-2517624 CCCAGGGGCTGCCATGCTGGGGG - Intergenic
925438585 2:3863925-3863947 CCCAGGCCCTGCAATGCTGATGG - Intergenic
925829833 2:7883120-7883142 CTCAGGCCTTACCATGAAGCAGG + Intergenic
928401047 2:30979044-30979066 CACAGGCCATGGCCTGATGGGGG + Intronic
928436304 2:31256865-31256887 CCAAGGCCATGCAATGCTGGGGG - Intronic
928691456 2:33803917-33803939 GCCAGGCCTTCCCATGGAGGTGG + Intergenic
929601715 2:43208599-43208621 CCCAGGCCAGGCCAGGCTGGAGG + Intergenic
929603925 2:43222303-43222325 CCCAGGTCTTGGCATGGTGGGGG - Intergenic
929664393 2:43822531-43822553 CCCAGGCCCTGCCGTGAATGTGG + Intronic
931405797 2:61977109-61977131 ACCATGCCTGGCCATGATGTGGG + Intronic
932577472 2:72970632-72970654 CCCAGCCTTTGTCCTGATGGTGG - Intronic
933456449 2:82525593-82525615 CCCAGTCCTTGCAAGGCTGGTGG - Intergenic
934779439 2:96960433-96960455 CCCTTGCCTTGCCAGGATGCTGG - Exonic
936486103 2:112927081-112927103 CCCTGGTGTTGCCATGATGACGG + Intergenic
938753731 2:134360912-134360934 CCCAGGCTTTTGCCTGATGGGGG - Intronic
938954950 2:136288710-136288732 CCCTGTCCTTGCCATCATTGTGG + Intergenic
942976189 2:182021107-182021129 CCCATTCTTTCCCATGATGGAGG - Intronic
948551937 2:238778627-238778649 CCCAGGCACAGCCATGAGGGTGG - Intergenic
948555527 2:238807372-238807394 CCCAGGCCGTGACATGATGACGG - Intergenic
948690157 2:239696953-239696975 CTCAGGCCAGGCCATGGTGGTGG - Intergenic
948843721 2:240672938-240672960 CCCAGGCCTCGCCATGCAGGAGG - Intergenic
1169212582 20:3775680-3775702 CCCAGCCTTTGCCATGTAGGAGG - Intergenic
1169910620 20:10644937-10644959 CCCAACCCCTGCCATAATGGGGG - Exonic
1170986672 20:21265593-21265615 CCCAGGCCCTGCTCTCATGGTGG - Intergenic
1172484572 20:35290708-35290730 CACAGGCCTGGCCAGGGTGGGGG + Intronic
1172700726 20:36852238-36852260 CCCAGGCCTCGGCCTGAGGGAGG - Intronic
1173205692 20:40991443-40991465 CCCAGACCTTGCAATTCTGGAGG + Intergenic
1174115972 20:48226491-48226513 CCCAGGCCTGGGCATTATGCTGG + Intergenic
1175100826 20:56577644-56577666 CCTAGGCCTTGCCATCAAAGAGG - Intergenic
1175296947 20:57915064-57915086 CCCAGGGCATCCCATGATGAGGG + Intergenic
1175913383 20:62414938-62414960 CCCAGGCCTGGCCACTCTGGAGG + Intronic
1175918641 20:62439582-62439604 TCCAGGCCTTTCCTTGCTGGGGG + Intergenic
1176090565 20:63316548-63316570 CCCAGGGTTTGACCTGATGGTGG + Exonic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1178177912 21:30126117-30126139 CCCAGGCCCTCCCAGGAGGGTGG - Intergenic
1178873596 21:36395544-36395566 CCCGGGCCCTGCCTTTATGGAGG + Intronic
1178901797 21:36604804-36604826 CCCAGGCCATCCCAGCATGGGGG + Intergenic
1179477692 21:41658463-41658485 CCCAGGCGTTGCCATGGCGATGG + Intergenic
1179545115 21:42108373-42108395 CCCAGGCCATGCTAGGGTGGTGG + Exonic
1179885190 21:44310860-44310882 CCCAGGCCCTGGGATGATGGTGG + Intronic
1179900523 21:44391120-44391142 CCCAGCCCTTCCCTTGAGGGTGG + Intronic
1181118641 22:20650414-20650436 CTCAGGCCTGGCCATGATGCTGG + Intergenic
1181182817 22:21079328-21079350 CCCAGGCCCTGCCCCCATGGGGG + Intergenic
1181359166 22:22322059-22322081 GCCTGGCCTGGCCCTGATGGAGG + Intergenic
1181369270 22:22403813-22403835 GCCTGGCCTGGCCCTGATGGAGG + Intergenic
1183341569 22:37284596-37284618 CCCAGGCCAGGCCAGGATGATGG - Intronic
1183479769 22:38057161-38057183 CCCTGCCCTTCCCAAGATGGCGG + Intronic
1184652538 22:45925741-45925763 CCCAGGAGCTGCCCTGATGGTGG + Intronic
1184852044 22:47126582-47126604 CTCAGGCCTTCCAATGAGGGCGG + Intronic
1185194184 22:49458173-49458195 CCGAGGCCTGGCCAGGATGGGGG + Intronic
1185228793 22:49668397-49668419 TCCAGGCCTTGCCACCATGGTGG + Intergenic
949571706 3:5300113-5300135 CCCAGACCTTCCCATGAATGGGG - Intergenic
949872794 3:8603483-8603505 CCCAGGCCTTGCCTTGCTTCCGG - Intergenic
951484223 3:23194003-23194025 GCCAGGCATTGCCATGTTGAGGG - Intergenic
953970556 3:47343882-47343904 CCCATGGCGTGCCATGAGGGAGG + Exonic
954439261 3:50512653-50512675 CCCAGGCCTCAGCGTGATGGAGG - Intergenic
955891638 3:63656302-63656324 CCCAGGCCCTGGCATGTTGTAGG - Intronic
960481906 3:118201764-118201786 CCCAGGCTTTGCCCTGATGGTGG + Intergenic
961048476 3:123726061-123726083 CACAGGGCTTGCCGTGATGGAGG - Exonic
962431986 3:135328416-135328438 ACCAGGGATTGCCATGATGCAGG - Intergenic
966732717 3:183163748-183163770 CCCAGGCCTCGCCAGGACCGCGG + Intronic
968161553 3:196431781-196431803 CACCGGCCTTGCCGTGAAGGCGG + Intronic
968509109 4:987566-987588 CCCTGGCCCTGCCAGGAAGGCGG - Intronic
969101692 4:4774454-4774476 ACCAGCCCTTGCCATCATGTTGG - Intergenic
970710629 4:18858367-18858389 CCCAGGCATTGTGATGATGCTGG - Intergenic
971299529 4:25430303-25430325 CCCTGGCCATGCCCAGATGGAGG - Intergenic
974746788 4:66087959-66087981 CTCTGCCCTTTCCATGATGGAGG + Intergenic
974868190 4:67605347-67605369 CCCTGGCCCTGCCCTGAGGGTGG - Intronic
975655524 4:76637772-76637794 CCCAGGCCTAGTGATGAGGGTGG - Intronic
979692986 4:123580379-123580401 CCCAGGCTTTGCCATAAATGAGG - Intergenic
984400911 4:179262365-179262387 CCCAAGCCTTGCCACACTGGAGG - Intergenic
985494949 5:199151-199173 CCCACTCCTTGCCAGGATGGTGG - Exonic
987578196 5:19757282-19757304 CTCTGACCTTTCCATGATGGAGG + Intronic
988690344 5:33565505-33565527 ACCAGGCCCTGTCATGAGGGGGG + Intronic
989123223 5:38025691-38025713 CCCAGGCCCTGGCGTGAAGGTGG + Intergenic
995418246 5:111934153-111934175 CCTAGGTCTGCCCATGATGGTGG - Intronic
995624778 5:114064353-114064375 CCCAGGCCTTAAGAGGATGGTGG + Intergenic
997079679 5:130723697-130723719 GCCAGGCATGTCCATGATGGGGG + Intergenic
997458346 5:134034453-134034475 CACAGGCCCTGCCAAGGTGGAGG + Intergenic
997661742 5:135594562-135594584 CCCAGTCCTTGGCATGTGGGAGG + Intergenic
999276764 5:150336508-150336530 CCCAGGTGATGCCATGATGCTGG + Intronic
1001330160 5:170756281-170756303 CCCTGGGCTTGGCATGCTGGAGG - Intergenic
1003563713 6:7204612-7204634 CCCAGGACCTGCCAAGCTGGAGG - Intronic
1003711007 6:8590162-8590184 CCCAGGCCCTGCCCTGATGGAGG - Intergenic
1003968996 6:11280475-11280497 CCCAGTCCTCCCCATGGTGGGGG - Intronic
1004890426 6:20095861-20095883 TCCAGGCTTTCCCTTGATGGTGG - Intergenic
1006831008 6:36968429-36968451 CATAGGCCTAGACATGATGGTGG + Exonic
1006845148 6:37056537-37056559 CCTAGGCCTTGGCAAGATGCTGG - Intergenic
1014092121 6:117415815-117415837 CCCAGGTGTTGCAATGCTGGTGG - Intronic
1015961011 6:138649744-138649766 CATAGGCCTAGACATGATGGTGG + Intronic
1017131862 6:151114603-151114625 CCCAGGCCTGGCCCTCATGTTGG - Intergenic
1017387768 6:153906205-153906227 CCCAGGCTTTTCCTTGCTGGGGG - Intergenic
1018417949 6:163617629-163617651 CAGAGGCCTTGTGATGATGGAGG + Intergenic
1018655704 6:166033908-166033930 CCCAGGCCTGGGGATGTTGGTGG - Intergenic
1019685306 7:2378806-2378828 CCCCGCCTTTGCCATGATGGCGG - Intronic
1022728953 7:33005115-33005137 CCCAGGCCTGGCGTTCATGGCGG + Intronic
1023870853 7:44262343-44262365 CCCAGGCCTTGCCTTTGTCGGGG - Intronic
1028493977 7:91443826-91443848 TCCATGCCTTTCCATGGTGGAGG + Intergenic
1030689953 7:112522172-112522194 CCCAGGTCATGCCTTCATGGGGG + Intergenic
1031951989 7:127902344-127902366 TGCAGGCCTTGCCTTGAAGGAGG + Intronic
1032002824 7:128276326-128276348 CCTGGGCCTGGCCATCATGGTGG + Intergenic
1032460496 7:132106619-132106641 CCCAGGCCTCACCTTGGTGGTGG + Intergenic
1034493579 7:151407403-151407425 CCCAGGCTTTGCCAGGCTGCCGG - Intronic
1035293413 7:157854248-157854270 CCCAGCCCTTGCCTTCATGTCGG - Intronic
1036773849 8:11596721-11596743 CCCAGGTCTTCCCATGTTTGTGG + Intergenic
1038018068 8:23531257-23531279 CCCAAGCCTTTCCATGATGGAGG - Intronic
1038423654 8:27451100-27451122 CCCAGGCCTTGGCATGGAGGAGG - Intronic
1040567426 8:48580498-48580520 GACAGGCATGGCCATGATGGAGG + Intergenic
1042328887 8:67556974-67556996 GCCAGACCTTGCCATGGTTGGGG + Intronic
1045388207 8:101690806-101690828 CTCATGCCTTGCCAAGCTGGAGG - Intronic
1047544085 8:125798132-125798154 CCCAGTCCTTGTGATGGTGGCGG - Intergenic
1048685292 8:136898285-136898307 CCCAGTCCTTGGCATATTGGAGG - Intergenic
1049384378 8:142333800-142333822 TCCAGGCCTTGCCATGAGTGCGG - Intronic
1049384388 8:142333845-142333867 CTCAGGCCTTGCCTTCCTGGAGG - Intronic
1049839377 8:144761237-144761259 CCCAGGCCGAGCCCTGATGGTGG - Intergenic
1050255765 9:3790370-3790392 GGGAGGCCTTGCAATGATGGTGG - Intergenic
1053066922 9:35075508-35075530 CCCAGGCCTGGCCCTGAAGCAGG + Exonic
1057547985 9:96032202-96032224 CCCTGGCCTTTCCCTGATGAAGG - Intergenic
1060886085 9:127153562-127153584 CTAAGGCCCTGTCATGATGGCGG + Intronic
1061589178 9:131587864-131587886 CCCCGGCTTTCCCCTGATGGGGG + Intronic
1061893267 9:133633839-133633861 CCCAAGGCTGGCCAGGATGGAGG + Intergenic
1061965007 9:134008453-134008475 CCCAGGCCTTGCCCTCCAGGTGG + Intergenic
1185817215 X:3167331-3167353 CCCAGCCCTTGCACTGATGGAGG - Intergenic
1186014288 X:5173662-5173684 CCTATGCCTTGCCATTCTGGGGG - Intergenic
1186840481 X:13479959-13479981 CCCTGGCCTTCCCATGATCACGG - Intergenic
1191234685 X:58124808-58124830 CCCAGGCATTTCAATGATGGAGG + Intergenic
1194589032 X:95773641-95773663 CTCAGTCCTTGCCTTGATGGAGG + Intergenic
1197159427 X:123307158-123307180 TCCTGGCTTTGCCTTGATGGTGG - Intronic