ID: 1154066692

View in Genome Browser
Species Human (GRCh38)
Location 18:11113341-11113363
Sequence ATTTTGTCCAGGTTGGTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 1, 2: 8, 3: 19, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154066692_1154066697 10 Left 1154066692 18:11113341-11113363 CCATTGACCAACCTGGACAAAAT 0: 1
1: 1
2: 8
3: 19
4: 194
Right 1154066697 18:11113374-11113396 AACTTGACCAAACTTTAATCAGG 0: 1
1: 2
2: 14
3: 116
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154066692 Original CRISPR ATTTTGTCCAGGTTGGTCAA TGG (reversed) Intronic
901610530 1:10494518-10494540 ATTTTGGCCAGATCAGTCAAGGG + Intronic
902267822 1:15280906-15280928 ATTTTGGCCAGGTGGGTTAGGGG - Intronic
902884399 1:19394200-19394222 ATGTTGGCCAGGTTGGTCTCAGG + Intronic
902982328 1:20133819-20133841 ATGTTGCCCAGGCTGGTAAAAGG + Intergenic
906808816 1:48805702-48805724 ATATTGTCCCTGTTGGACAAAGG - Intronic
907690495 1:56659703-56659725 ATTTTGTCCAGGCTGGTTCAAGG - Intronic
908029676 1:59986334-59986356 AGTTTATCCAGGATGGACAATGG - Intergenic
908079975 1:60566493-60566515 ATTTTGTCCAGGTTGGTGAGTGG - Intergenic
908730402 1:67220449-67220471 GTTTTGTCAATTTTGGTCAAAGG - Intronic
908941372 1:69438604-69438626 ATTTTTTCCAGATTGGTGAGTGG - Intergenic
908985614 1:70016328-70016350 ATATTGTTCAGGCTGCTCAATGG + Intronic
909505109 1:76379411-76379433 ATTTTTTGCAGTTTGTTCAATGG - Intronic
909977674 1:82064309-82064331 AGTTTCTCCAGGGTGGGCAAGGG + Intergenic
911764462 1:101657078-101657100 AATTTGCCCAGGGTGGTCAGAGG - Intergenic
915585673 1:156842546-156842568 ATTTTGGCCAAATGGGTCAAGGG - Intronic
916956797 1:169845938-169845960 ACTTTGTCCAGGTTCATCAGAGG + Intronic
917327853 1:173851510-173851532 ACTTTGACCAAGTTGGTCCAGGG - Intronic
922423769 1:225475803-225475825 ATGTTGGCCAGGCTGGTCACCGG - Intergenic
1067927847 10:50528694-50528716 ATTTTGCCCAGGCTGTTCTAGGG - Intronic
1068523226 10:58100741-58100763 ATTTTGTCCAGATTGGTCTGTGG - Intergenic
1068674998 10:59761629-59761651 ATTTTGTCCACATTGGTGAGTGG - Intergenic
1069162018 10:65104597-65104619 ATTTTTGACAGGTTTGTCAAAGG - Intergenic
1069721147 10:70550054-70550076 AATTTGGCCAGGTAGGTCACTGG - Intronic
1070489300 10:76961096-76961118 ATTTTGCCCAGATTCATCAAAGG - Intronic
1073050873 10:100666454-100666476 ATTTTGGCCAGGCTGGTCTCAGG - Intergenic
1075987349 10:126799331-126799353 TTTTTGTCCAGGTTGGTCAGTGG - Intergenic
1076475213 10:130746835-130746857 GTTTTGTCCAGAGTGGTCAGTGG - Intergenic
1081141243 11:39503152-39503174 ATTTTGTCCAGATTGGTCCATGG + Intergenic
1085943729 11:81240016-81240038 GATTTGTCCTGGTTGTTCAAAGG + Intergenic
1086269344 11:85041831-85041853 TTTTTGTCCATGTTAGTGAATGG - Intronic
1089753887 11:120671901-120671923 GTTTTTGCCAGGTTTGTCAAAGG + Intronic
1091422950 12:359540-359562 ATGTTGCCCAGGTTGGTCTCTGG - Intronic
1091606897 12:1960394-1960416 ATTTTGGAGATGTTGGTCAAAGG + Intronic
1092555082 12:9550521-9550543 ATTTTGTGCAGGGTGTTCATAGG + Intergenic
1094126879 12:27032776-27032798 ATTTTGTCCAGATTAGTCTATGG - Intronic
1094517014 12:31140154-31140176 ATTTTGTGCAGGGTGTTCATAGG - Intergenic
1095077134 12:37944635-37944657 TTTTTTTTCAGGTTTGTCAAAGG - Intergenic
1095091821 12:38114523-38114545 ATTTTGGCCAGGCTGGTCTCAGG + Intergenic
1095474961 12:42577081-42577103 ATTAAATCCAGTTTGGTCAATGG + Intronic
1098120089 12:67227371-67227393 GTTTTTTTCAGGTTTGTCAAAGG + Intergenic
1098327956 12:69322396-69322418 ACTGTGTCCAGGCTGGTGAAAGG - Intergenic
1098396861 12:70028655-70028677 AATTTGGCCAGGGTGGTCAGAGG - Intergenic
1099370743 12:81826664-81826686 ATTCTTTCCATGTTGGTTAAAGG + Intergenic
1099699579 12:86066425-86066447 TTTTTTTTCAGGTTTGTCAAAGG - Intronic
1099963559 12:89420488-89420510 ATTTCCTTCAGGTTGGCCAATGG + Exonic
1100255202 12:92876277-92876299 ATGTTGTCCAGGCTGGTCTTAGG + Intronic
1100321326 12:93495784-93495806 ATTTTATCTAGGTGGGTCACAGG - Intronic
1100670652 12:96808821-96808843 ATTTTATTCAGGTTTGTCCAAGG + Intronic
1101620501 12:106382442-106382464 ATTTTGTCCAGATCCATCAAAGG + Intronic
1104146600 12:126040088-126040110 ATATTGTCCAGGCTGGTCTCAGG + Intergenic
1104604739 12:130179750-130179772 ATTGGGTCCAGTTTGGCCAACGG + Intergenic
1105835312 13:24205799-24205821 TTTTTGGTCAGGTTTGTCAAAGG - Intronic
1110379233 13:74830883-74830905 ATTTTGCCCAGATCTGTCAAAGG - Intergenic
1110621304 13:77598882-77598904 ATGTTGCCCAGGTTGGTCTCGGG + Intronic
1111144160 13:84158245-84158267 ATTTTGTCCAGATTTGTCAGTGG - Intergenic
1114194458 14:20464987-20465009 ATGTTGCCCAGGCTGGTCATTGG + Intergenic
1119135376 14:72213468-72213490 ATTTTGTCCAGATTGATCACAGG - Intronic
1124201451 15:27681841-27681863 ATTTTGTCCAGATTGGTGAGTGG - Intergenic
1125514570 15:40310612-40310634 CTGTTGTCCATCTTGGTCAAGGG + Intergenic
1126940817 15:53763178-53763200 ATTCTGTCCACATTGGTCAGTGG - Intergenic
1127201874 15:56663079-56663101 ATTTTGCCCAGGCTGGTCATGGG - Intronic
1132081783 15:98872128-98872150 ATTTAGTGCAGGTTGGACATGGG - Intronic
1133310427 16:4842561-4842583 ATGTTGTCCAGGCTGGTCTCCGG + Intronic
1137287192 16:47026266-47026288 GTTTTGTCAAGGCTGGTCGAAGG - Intergenic
1137558481 16:49488386-49488408 ATTTTGCCCAGGCTGGGAAATGG - Exonic
1139007228 16:62587578-62587600 ATTTTGTTCATTTTGGCCAAGGG - Intergenic
1139940127 16:70599568-70599590 ATGTTGGCCAGGTTGGTCTCAGG + Intronic
1140606178 16:76541569-76541591 ATTTTGTCCAAGATAGTAAATGG + Intronic
1147464503 17:40600256-40600278 ATATTGCCCAGGCTGGTAAATGG + Intergenic
1148884903 17:50765523-50765545 AGTTTGTTCAGGTTGGTAAATGG + Intergenic
1149324987 17:55520919-55520941 ATATTCTCCAGGTTGGTCTCGGG - Intergenic
1149348396 17:55762263-55762285 ATTTTGTTCTGGTTGATCAGTGG + Intronic
1149755945 17:59185912-59185934 ATATTGTCCAGATTGGTCAGTGG + Intronic
1150769904 17:68032157-68032179 ATGTTGCCCAGGCTGGTGAATGG + Intergenic
1151251633 17:72840438-72840460 ACATTGTCCAGGTGGGCCAAGGG - Intronic
1153677235 18:7466616-7466638 ATATGGCCCAGGGTGGTCAAAGG - Intergenic
1154066692 18:11113341-11113363 ATTTTGTCCAGGTTGGTCAATGG - Intronic
1155847642 18:30729637-30729659 ATTTTTGTCAGGTTTGTCAAAGG + Intergenic
1157736339 18:50053182-50053204 AGTCTGTCCAGGTTGCTCATGGG - Intronic
1158978246 18:62732671-62732693 ATTTTGTCCAGATGTATCAAGGG - Intronic
1160298113 18:77656007-77656029 CTTTTGTCCCAGTTAGTCAAGGG - Intergenic
1160339778 18:78079780-78079802 GTTTTGGCCAAGTTGGACAAAGG + Intergenic
1161736069 19:5992809-5992831 TCTTTGTCCAGGATGGTCAATGG - Intergenic
1162919504 19:13892111-13892133 ATGTTGCCCAGGCTGGTCAAGGG + Intronic
1162929175 19:13948055-13948077 ATGTTGCCCAGGTTGGTCTCCGG + Intronic
1163031561 19:14547862-14547884 ATGTTGCCCAGGTTGGTCTTGGG + Intronic
1166006643 19:39912686-39912708 ATTTTGCCCAGGCTGGTCTCGGG - Intronic
1166672066 19:44716535-44716557 ATTTTGGTCAGGTTGGTCTCAGG + Intergenic
925835396 2:7940472-7940494 GTCTTGTCCAGATTGGTCAATGG - Intergenic
926786168 2:16520539-16520561 ATTATGTCCCGGTTGGACAGAGG - Intergenic
928021335 2:27707302-27707324 ATTATGTCCAGGATGGTAGAGGG - Exonic
929668657 2:43852664-43852686 ACCTTGTCCAGGCTGGCCAAAGG + Exonic
929732521 2:44511041-44511063 ATATTGGCCAGGTTGGTCTTGGG + Intronic
930042966 2:47143040-47143062 ATTTTGGCCAGGCTGGTCTTAGG + Intronic
930102081 2:47611131-47611153 ATTTTGTACAGGTCTGTCATCGG + Intergenic
930300457 2:49609399-49609421 AGTGGGTCCAGGTTGGGCAAAGG - Intergenic
930599807 2:53429921-53429943 ATTTTGTCTAGGTTGGCCAAGGG - Intergenic
931123958 2:59253188-59253210 ATTTAGGCCATGCTGGTCAAAGG - Intergenic
931724476 2:65095553-65095575 ATGTTGACCAGGCTGGTCACAGG + Intronic
933114207 2:78446535-78446557 ATTTTTCCCGGGTTGGTCATGGG + Intergenic
935459891 2:103317788-103317810 ATGTTGGCCAGGCTGGTCACTGG + Intergenic
935932275 2:108140400-108140422 TTATGGTCCAGGTTGGTCCAGGG - Intergenic
936632238 2:114215945-114215967 AATGTCTCCAGGATGGTCAAGGG + Intergenic
939424312 2:142015238-142015260 ATTTTTGTCAGGTTTGTCAAAGG - Intronic
939931258 2:148236271-148236293 ACTTTGCCCAGATTGGTCAGAGG + Intronic
943485077 2:188469160-188469182 ATTTTGTCCAGTTTGGTCAGTGG + Intronic
944300205 2:198115277-198115299 ATTTTCTCCAGATTGGTTAGTGG + Intronic
944500150 2:200350735-200350757 ATGTTGGCCAGGCTGGTCATCGG + Intronic
944631803 2:201634386-201634408 ATTTTGTTCAGGATGACCAATGG - Intronic
945635222 2:212340651-212340673 ATGTTGTCCAGGCTGGTCCCAGG + Intronic
946645348 2:221827332-221827354 ACTTTGTCCAGATCCGTCAAAGG + Intergenic
949019270 2:241732056-241732078 ATGTTGGCCAGGTTGGTGTAGGG + Intergenic
1170269516 20:14508645-14508667 TTTTTGTCCACGTTGTTCATAGG - Intronic
1170672910 20:18451684-18451706 ATCTTTTCCAGCTTTGTCAATGG + Intronic
1172195151 20:33086391-33086413 ATATTTTCCAGGCTGGTCGAAGG - Intronic
1175511256 20:59527794-59527816 AGTTTGGCCAGGGTGGTCAGAGG + Intergenic
1176873413 21:14102451-14102473 ATTTTGGCCAGGCTGGTCTCAGG - Intergenic
1177381288 21:20347605-20347627 ATTTTGTCTAGATTGGTTAGTGG - Intergenic
1178150558 21:29789303-29789325 ATTTTGTTCTGATTGGTCAGTGG - Intronic
1178157766 21:29874472-29874494 ATTTTGTTCTGATTGGTCATGGG - Intronic
1178687809 21:34724983-34725005 ATTTTCACCAGCTTGGGCAAGGG + Intergenic
1181091712 22:20477564-20477586 TTTTTGCCCAGGCTGGGCAATGG - Intronic
1184304048 22:43583029-43583051 ATTTTGTCCAGATTAGTCAGTGG - Intronic
1184923974 22:47624712-47624734 ATTTTCTGCAGGGTGGTCAAAGG - Intergenic
1185225795 22:49651410-49651432 ATGTTGGCCAGGCTGGTCAACGG - Intronic
952071143 3:29637381-29637403 ATTTGGTTAAGGTTGGTTAAAGG + Intronic
952625224 3:35394842-35394864 TTTTTATCCTGTTTGGTCAATGG + Intergenic
953438614 3:42899153-42899175 ATTTTGACCAGATTGTCCAAGGG - Intronic
953467896 3:43140476-43140498 ATATTGTCCAGGCTGGTCTCAGG - Intergenic
954466178 3:50656338-50656360 ATTCTGTCCTGGGTGGTCAGTGG - Intergenic
954699573 3:52444151-52444173 TTTTTGCCCAGGGTGGCCAACGG - Intronic
955792403 3:62602243-62602265 ATTTTGTGCAGGTTGGTGCTGGG + Intronic
956399257 3:68859594-68859616 CTTTTGACCAAGTTGGTTAATGG + Intronic
958116652 3:89228312-89228334 ATTTTGTCCAATTTTTTCAAAGG - Intronic
961779105 3:129311174-129311196 CTTTAGACCAGGTTGGTCTAGGG + Intergenic
964346836 3:155762359-155762381 ATGTTGGCCAGGCTGGTCATTGG + Intergenic
965601232 3:170456648-170456670 ATGTTGCCTAGGCTGGTCAAGGG + Intronic
966359380 3:179118818-179118840 ATGTTGTCCAGGTTGGTTTCAGG - Intergenic
970125591 4:12806490-12806512 ATTTTGTCCTTGTTGGCAAAGGG - Intergenic
970462357 4:16287700-16287722 CTGTTTTCCAGGCTGGTCAAGGG + Intergenic
971698570 4:29937513-29937535 ATTTTGTCCAGATGGCTCACTGG + Intergenic
972042452 4:34620719-34620741 ATTTGGCCAAGGTTGTTCAAAGG + Intergenic
979615382 4:122736480-122736502 ATTATGTCCAGTTTTGTCTAAGG - Intronic
983227614 4:165099740-165099762 ATGTTGCCCAGGTTGGTCACTGG - Intronic
983476157 4:168214179-168214201 ATTTTTGTCAGGTTTGTCAAAGG + Intergenic
983723034 4:170882165-170882187 ATTTTTGTCAGGTTTGTCAAAGG - Intergenic
984742044 4:183174243-183174265 TTTCTGCCCAGGTTGGGCAAAGG + Intronic
985527279 5:412921-412943 ATGTTAGCCAGGCTGGTCAATGG + Intronic
986420451 5:7575765-7575787 ATTTTGTTAAGGTTGGTTGATGG - Intronic
988320823 5:29694123-29694145 GTTTTGTCCAGATAGGTAAAAGG - Intergenic
990439081 5:55825713-55825735 TTGTTCTCCAGGATGGTCAATGG + Intergenic
991365055 5:65859669-65859691 ATTTTGTCCAGATTGGCCTGTGG + Intronic
993908585 5:93652235-93652257 ATTTTCTCCTGGTTTTTCAAAGG + Intronic
993978043 5:94506609-94506631 ATTTTGTCCATGGTTTTCAATGG + Intronic
994580971 5:101641384-101641406 ATGTTGTCCAGGCTGGTCTCCGG - Intergenic
994914342 5:105954333-105954355 ATTTGGAACAGGTTGGTAAAGGG - Intergenic
996466492 5:123808487-123808509 TTTTTCTCCAAGTTGTTCAATGG - Intergenic
997419148 5:133752141-133752163 GTTTTGAGCAGGTTGGGCAAAGG - Intergenic
997835183 5:137186490-137186512 ATCTTGTCCAGTTTGGTCCAGGG - Intronic
997993477 5:138565982-138566004 ATGTTGGCCAGGTTGGTCCTTGG - Intronic
1001183402 5:169542432-169542454 ATTTTGTCCAGATTCATCAGAGG - Intergenic
1001477148 5:172058685-172058707 ATTTTGCCCAGGCTGGTCTCAGG - Intronic
1002515273 5:179753483-179753505 AGGGTGTCCAGCTTGGTCAAAGG + Intronic
1003494780 6:6654225-6654247 ATTTTGAGCAGGGTGGTGAAAGG - Intronic
1004876545 6:19960808-19960830 ATTTTGTCCAAGTTGCTGATGGG + Intergenic
1006253522 6:32811125-32811147 ATTGTGTCCAGCCTGTTCAATGG - Intergenic
1008144737 6:47877872-47877894 TTTTTGAACAGGTTGGTCAAAGG - Intergenic
1008182618 6:48351245-48351267 TTTTTGTCCAGTTTGCTCATAGG - Intergenic
1009919763 6:70043124-70043146 ATTTTGCCCAGGTTCATCAGAGG + Intronic
1010460300 6:76106891-76106913 GTTTTTTTCAGGTTTGTCAAAGG + Intergenic
1010503994 6:76633811-76633833 AGTTTGGCCAGGTAGGTCAGAGG - Intergenic
1010598039 6:77789120-77789142 ATTTTTGTCAGGTTTGTCAAAGG - Intronic
1014037081 6:116779108-116779130 ATGTTGGCCAGGCTGGTTAAAGG + Intergenic
1014197838 6:118579317-118579339 ATATTTTCCAATTTGGTCAAGGG + Intronic
1014503459 6:122223482-122223504 ACTTTATCCTGGTTGGTGAAAGG - Intergenic
1019099980 6:169622323-169622345 ATTTTGCCCAGGTTGGGGATGGG - Intronic
1021713365 7:23438574-23438596 GTGTTGCCCAGGCTGGTCAAAGG - Intronic
1022008339 7:26287884-26287906 ATGTTGGCCAGGTTGGTCTTGGG + Intergenic
1022737396 7:33089060-33089082 ATGTTGGCCAGGCTGGTCACTGG + Intergenic
1023413047 7:39906853-39906875 ATGTTGTCCAGGTTAGTCTCAGG - Intergenic
1024195956 7:47059218-47059240 ATTGTGTCTAGTTTGGTCAGTGG - Intergenic
1025171613 7:56763376-56763398 ATTTTTTCCCAGTTTGTCAATGG + Intergenic
1028258570 7:88632260-88632282 ATTTTTGTCAGGTTTGTCAAAGG - Intergenic
1029265083 7:99332516-99332538 ATTCTGTTCAGGGTCGTCAATGG - Intronic
1029900637 7:104035724-104035746 ATTTTGTCTAGGTCTGGCAAAGG + Intergenic
1032347542 7:131130848-131130870 ATGTTGTCCAGGCTGGTCTTAGG - Intronic
1036837511 8:12087272-12087294 ATTTTGTCAAGTTTCGTTAATGG + Intergenic
1036859303 8:12333520-12333542 ATTTTGTCAAGTTTCGTTAATGG + Intergenic
1038806534 8:30798235-30798257 ATCTTGCCCAGTTTTGTCAAGGG - Intronic
1039357519 8:36837399-36837421 AATTTTTCCAGGTTGTTTAAGGG + Intronic
1039778445 8:40759962-40759984 ATTTTGTCCAGATTTGTTAGTGG - Intronic
1041357733 8:57019006-57019028 ATTTTGTCCATGTTCATCAGTGG - Intergenic
1041956577 8:63562747-63562769 ATCTTGTCCAGATTGGTCAATGG - Intergenic
1042251920 8:66764677-66764699 ATGTTGTCCAGGCTGGTCTCAGG + Intronic
1044179128 8:89166932-89166954 ATTTTTGTCAGGTTTGTCAAAGG - Intergenic
1044825971 8:96197295-96197317 ATGTTGGCCAGGCTGGTCACCGG - Intergenic
1046502699 8:115098913-115098935 GGTTTCTCCATGTTGGTCAAGGG - Intergenic
1048779212 8:137983093-137983115 ATTGTGGAGAGGTTGGTCAAAGG - Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1050325993 9:4497534-4497556 ATGTTGTCCTTGTTTGTCAAGGG + Intronic
1051393363 9:16590602-16590624 ATGTTGTCCAGGCTGGTCTTTGG - Intronic
1051728691 9:20115251-20115273 ATTCTGCCCAGATTGGTAAAGGG + Intergenic
1051912987 9:22176293-22176315 ATTTTATACACTTTGGTCAAAGG + Intergenic
1053515691 9:38728859-38728881 ATTTTCTTCAGGTAGGGCAATGG - Intergenic
1053557826 9:39156412-39156434 ATGTTGTTCAGGTTGGTCTGAGG - Intronic
1054139288 9:61462539-61462561 ATGTTGTTCAGGTTGGTCTGAGG + Intergenic
1055236740 9:74131600-74131622 ATTTTGCCCAGCTTGGTCAATGG + Intergenic
1055872472 9:80899634-80899656 ATGTTGTCCAGATTCTTCAATGG - Intergenic
1056061972 9:82892847-82892869 ATTTTGTCCAGATTGGTCAATGG + Intergenic
1058428775 9:104899802-104899824 ACTTTGTCCAGTTTGTTCCATGG + Intronic
1061029362 9:128070441-128070463 ATGTTGGCCAGGTTGGTCTCGGG + Intronic
1186688894 X:11953802-11953824 ATTTTATCCAGATTAGTCAGGGG + Intergenic
1186972185 X:14859555-14859577 ATTTTATTCAGGTTTGTCCAGGG + Intronic
1188331590 X:28878540-28878562 ATTTTATCCAGATTAGTCAGAGG + Intronic
1189768574 X:44397786-44397808 ATTTTGTCCAGATTGATCAGAGG - Intergenic
1192537227 X:71938538-71938560 ATTTTGTGCAGAGTGGTGAAGGG + Intergenic
1192701013 X:73473034-73473056 ACTTTGTACAGATTGATCAAAGG + Intergenic
1195632415 X:107071427-107071449 TTTTTGTCTAGGTTGGTCTCAGG - Intronic
1196210101 X:112986450-112986472 ATGTTGCCCAGGCTGGTCTAAGG + Intergenic
1196825867 X:119739758-119739780 GTTTTGTGCAGGTTGGTAGAGGG - Intergenic
1197652799 X:129084307-129084329 ATTTTGACATGGTTGTTCAAAGG + Intergenic
1198057222 X:133007142-133007164 ATTTTGTCCAGATTGGTCAGTGG + Intergenic
1198682379 X:139196566-139196588 ATTATGTCCAATTTGGTGAATGG + Intronic