ID: 1154067155

View in Genome Browser
Species Human (GRCh38)
Location 18:11118157-11118179
Sequence GGTACAGATGTCCCTACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 293}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154067151_1154067155 29 Left 1154067151 18:11118105-11118127 CCTCTGTTAAGTTCATCATCTGT 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1154067155 18:11118157-11118179 GGTACAGATGTCCCTACAAATGG 0: 1
1: 0
2: 2
3: 14
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154067155 Original CRISPR GGTACAGATGTCCCTACAAA TGG Intronic
901384426 1:8898083-8898105 GCTACAGATGGTCTTACAAATGG + Intergenic
902763985 1:18602868-18602890 GGCAAAGCAGTCCCTACAAATGG + Intergenic
906767133 1:48443871-48443893 GCTACAGATGGTCTTACAAATGG + Intronic
907793674 1:57693060-57693082 GCTACAGATGGTCTTACAAATGG + Intronic
908300985 1:62761078-62761100 GCTACAGATGGTCTTACAAATGG + Intergenic
908658940 1:66417741-66417763 GCTACAGATGGTCTTACAAATGG - Intergenic
909579083 1:77212483-77212505 GGTACAGATGTGTGTACAAGTGG - Intronic
910396892 1:86802521-86802543 GCTACAGATGGTCTTACAAATGG - Intergenic
911299270 1:96152783-96152805 GCTACAGATGGTCTTACAAATGG + Intergenic
911751956 1:101505640-101505662 GCTACAGATGGTCTTACAAATGG + Intergenic
911845256 1:102744813-102744835 GCTACAGATGGTCTTACAAATGG - Intergenic
912021790 1:105115161-105115183 GCTACAGATGGTCTTACAAATGG + Intergenic
913383280 1:118232648-118232670 GCTACAGATGGTCTTACAAATGG + Intergenic
913470081 1:119178659-119178681 GCGACAGATGTTCTTACAAATGG + Intergenic
915261098 1:154677629-154677651 GCTACAGATGGTCTTACAAATGG + Intergenic
916084243 1:161257153-161257175 GCTACAGATGGTCTTACAAATGG + Intergenic
917227894 1:172803440-172803462 GCTACAGATGGTCTTACAAATGG + Intergenic
917445532 1:175103068-175103090 GCTACAGATGGTCTTACAAATGG - Intronic
917676678 1:177325228-177325250 GCTACAGATGGTCTTACAAATGG + Intergenic
918749770 1:188258216-188258238 GCTACAGATGGTCTTACAAATGG - Intergenic
920756557 1:208739272-208739294 GCTACAGATGGTCTTACAAATGG + Intergenic
923612516 1:235507354-235507376 GGTACAGCTGTCTCTACTCATGG + Intergenic
924861482 1:247927988-247928010 GGTACAGATGTCCCTTCAATAGG + Intergenic
1063076183 10:2719094-2719116 GGGACAGATGTCCCTATTATAGG - Intergenic
1063321161 10:5053867-5053889 GCTACAGATGGTCTTACAAATGG - Intronic
1063415276 10:5868186-5868208 GCTACAGATGGTCTTACAAATGG + Intronic
1064197651 10:13259193-13259215 GCTACAGATGGTCTTACAAATGG + Intergenic
1064603002 10:17012134-17012156 GCTACAGATGGTCTTACAAATGG - Intronic
1064700033 10:18009230-18009252 ACTAGAGATGTCCCTACAATGGG + Intronic
1066293505 10:34034996-34035018 GCTACAGATGGTCTTACAAATGG + Intergenic
1066613702 10:37276083-37276105 GCTACAGATGGTCTTACAAATGG - Intronic
1068501193 10:57841336-57841358 GCTACAGATGGTCTTACAAATGG + Intergenic
1069364666 10:67684722-67684744 GTTACAGATGGTCTTACAAATGG - Intronic
1069758847 10:70793631-70793653 GGTACAAATATCCACACAAAGGG - Intergenic
1069943226 10:71969468-71969490 AGTACAGATGTCCATAGAACGGG + Intronic
1071835290 10:89411986-89412008 GCTACAGATGGTCTTACAAATGG + Intronic
1072370781 10:94764727-94764749 GCTACAGATGGTCTTACAAATGG - Intronic
1074742351 10:116497472-116497494 GCTACAGATGGTCTTACAAATGG - Intergenic
1074988776 10:118683059-118683081 GGTACAGGTGTGACAACAAAAGG + Exonic
1075146887 10:119890078-119890100 GCTACAGATGGTCTTACAAATGG + Intronic
1076280381 10:129241832-129241854 GGTACAGGTGTGCATGCAAAGGG + Intergenic
1079017028 11:16877844-16877866 GATAAAAATGTCCCTCCAAAAGG + Intronic
1079448775 11:20581260-20581282 GGCACAGATGTCCTCACAAATGG + Intergenic
1079730686 11:23935493-23935515 GCTACAGATGGTCTTACAAATGG - Intergenic
1081033759 11:38116438-38116460 GCTACAGATGGTCTTACAAATGG + Intergenic
1081047225 11:38291294-38291316 GGCACAAATGTCCTTAAAAATGG + Intergenic
1081421949 11:42880975-42880997 GCTACAGATGGTCTTACAAATGG + Intergenic
1083301577 11:61742409-61742431 CGTCCAGTTGTCCCTACCAAGGG - Intronic
1083468452 11:62865211-62865233 GGTACACAAATCCCTACGAAAGG - Intronic
1084211524 11:67626069-67626091 GCTACAGATGGTCTTACAAATGG + Intergenic
1086054242 11:82628505-82628527 GCTACAGATGGTCTTACAAATGG + Intergenic
1087458690 11:98420200-98420222 GCTACAGATGGTCTTACAAATGG - Intergenic
1087682460 11:101232095-101232117 GCTACAGATGGTCTTACAAATGG - Intergenic
1088114744 11:106301574-106301596 GGTCCAAATCTCCCTATAAAGGG - Intergenic
1088493173 11:110406259-110406281 GCTACAGATGATCTTACAAATGG + Intergenic
1088761021 11:112928995-112929017 GGTACAGATGTTTCTGCAACTGG + Intergenic
1090058920 11:123447007-123447029 GTTACAGATGTCCCTTCCATTGG + Intergenic
1091609467 12:1992560-1992582 TGTAGAGATGTCCCTGCAACTGG + Intronic
1092472835 12:8794320-8794342 GCTACAGATGGGCTTACAAATGG + Intergenic
1093346151 12:18039847-18039869 GCTACAGATGGTCTTACAAATGG + Intergenic
1095663163 12:44761830-44761852 GGTACACATGGACGTACAAAAGG + Intronic
1097428561 12:59475140-59475162 GCTACAGATGGTCTTACAAATGG + Intergenic
1099414479 12:82370249-82370271 GTTACAGATGGTCTTACAAATGG - Intronic
1099576550 12:84390722-84390744 GTTACAGATGGTCTTACAAATGG - Intergenic
1099797905 12:87421756-87421778 GCTACAGATGGTCTTACAAATGG - Intergenic
1100050555 12:90443997-90444019 GCTACAGATGGTCTTACAAATGG - Intergenic
1100210454 12:92393526-92393548 GCTACAGATGGTCTTACAAATGG + Intergenic
1101705503 12:107217055-107217077 GCTACAGATGGTCTTACAAATGG + Intergenic
1102308398 12:111824485-111824507 GGTACAGATGTTTCTGCAACTGG + Intergenic
1103271630 12:119678225-119678247 GTTACAGTTGTCACTACTAAAGG + Intronic
1104194968 12:126528012-126528034 GCTCCAGCTGTCCCTATAAAAGG + Intergenic
1104306855 12:127617473-127617495 GCTACAGATGTTCCTACGAATGG + Intergenic
1104872401 12:132009399-132009421 GGTACAGATGAACCTTGAAATGG + Intronic
1105763031 13:23531154-23531176 GCTACAGATGGTCTTACAAATGG + Intergenic
1106163258 13:27219362-27219384 GCTACAGATGGTCTTACAAATGG + Intergenic
1106643556 13:31609595-31609617 GCTACAGATGGTCTTACAAATGG - Intergenic
1107959517 13:45545745-45545767 GACACAGGTGTCCCTACACAGGG - Intronic
1108515732 13:51200780-51200802 GCTACAGATGGTCTTACAAATGG - Intergenic
1108818389 13:54317487-54317509 GCTACAGATGGTCTTACAAATGG + Intergenic
1109952476 13:69516536-69516558 GGTGCTGATGCCTCTACAAAGGG + Intergenic
1111899988 13:94188716-94188738 GATACAGAGGTCCCTAAAGAAGG - Intronic
1111904907 13:94243942-94243964 GGTAAAGCTGCCCCTATAAATGG + Intronic
1112519693 13:100084589-100084611 GCTACAGATGGTCTTACAAATGG + Intergenic
1113550584 13:111190144-111190166 GCTACAGATGGTCTTACAAATGG - Intronic
1116283325 14:42939081-42939103 GGTACACATGTACATACAGAAGG + Intergenic
1116342652 14:43744644-43744666 GGTACATATGTACATAAAAATGG - Intergenic
1118319988 14:64747434-64747456 GGTACATATGACCCTATACAGGG - Exonic
1124044794 15:26138846-26138868 AATACAGCTGTCCCTAGAAAGGG + Intergenic
1124072392 15:26408061-26408083 GGTTCTGATGTACCTAAAAAAGG + Intergenic
1124211311 15:27767167-27767189 GCTACAGATGGTCTTACAAATGG + Intronic
1124670712 15:31635801-31635823 GGGACAGCTGTGGCTACAAACGG + Intronic
1126070638 15:44862274-44862296 GCTACAGATGGTCTTACAAATGG - Intergenic
1131639641 15:94278147-94278169 GGTACAGATACCCAGACAAATGG + Intronic
1139359138 16:66386468-66386490 GGTACATATGGCCATAAAAATGG - Intronic
1140114781 16:72032351-72032373 GATGCAGATGCCCTTACAAATGG + Intergenic
1141376028 16:83531615-83531637 ATTACAAATGTCCCTACAAGAGG + Intronic
1142124843 16:88405144-88405166 GGAACAGATGTCCACACAGAGGG + Intergenic
1144547267 17:16209083-16209105 GATACAGACATGCCTACAAAGGG + Intronic
1145232470 17:21184136-21184158 GGGACAGAGGTCACTGCAAATGG - Intronic
1145299107 17:21618263-21618285 GATACAGACATGCCTACAAAGGG - Intergenic
1145351175 17:22085020-22085042 GATACAGACATGCCTACAAAGGG + Intergenic
1145804975 17:27720239-27720261 GCTACAGATGGTCTTACAAATGG + Intergenic
1146311385 17:31771110-31771132 GCTACAGATGGTCTTACAAATGG + Intergenic
1147290739 17:39440665-39440687 GGTAAAGATGTTACTATAAAAGG + Exonic
1149445621 17:56711142-56711164 GGAACAGCTGTCCCTGCAAGGGG + Intergenic
1151567590 17:74907810-74907832 GCTACAGATGGTCTTACAAATGG - Intergenic
1153438364 18:5090252-5090274 GCTACAGATGGTCTTACAAATGG + Intergenic
1154067155 18:11118157-11118179 GGTACAGATGTCCCTACAAATGG + Intronic
1155475414 18:26232427-26232449 GCTACAGATGGTCTTACAAATGG - Intronic
1157857021 18:51112573-51112595 GCTACAGATGGTCTTACAAATGG - Intergenic
1158220759 18:55148362-55148384 GGTGCAGATGCCCCTGAAAATGG - Intergenic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1161582678 19:5089357-5089379 GCTACAGATATCCCTAGACATGG - Intronic
1161597639 19:5159067-5159089 GCTACAGATGATCTTACAAATGG - Intronic
1167876061 19:52413646-52413668 GGTACAGATGTTGCTGCAACTGG + Intronic
1167883086 19:52478459-52478481 GGTACAGATGTTTCTGCAATTGG + Intronic
925949268 2:8895778-8895800 CCTACAGATGTTCTTACAAACGG - Intronic
929330755 2:40677601-40677623 GCTACAGATGGTCTTACAAATGG + Intergenic
929500473 2:42486779-42486801 GGCACAGAGGTTCCTACAAAGGG - Intronic
931540881 2:63327828-63327850 GCTACAGATGGTCTTACAAATGG + Intronic
934867797 2:97828949-97828971 GCTACAGATGGTCTTACAAATGG + Intronic
935247981 2:101235993-101236015 GCTACAGATGGTCTTACAAATGG + Intronic
936016491 2:108962990-108963012 GGTGCAGATGTCCCTGGCAAGGG - Intronic
936238011 2:110761786-110761808 GGTACAGATCTCACTAGAGAAGG - Intronic
936802856 2:116288015-116288037 GCTACAGATGGTCTTACAAATGG + Intergenic
939852523 2:147318485-147318507 GCTACAGATGATCTTACAAATGG + Intergenic
940450788 2:153834101-153834123 GGTACAAATTTCCTTACAAGGGG - Intergenic
941243828 2:163072504-163072526 GCTACAGATGGTCTTACAAATGG + Intergenic
942444323 2:176067987-176068009 GGAACAGAGGCCCCTAAAAATGG - Intergenic
943134314 2:183892136-183892158 GCTACAGATGATCTTACAAATGG + Intergenic
943231355 2:185256613-185256635 CATACATATGTCCTTACAAATGG - Intergenic
943902334 2:193456149-193456171 GCTACAGATGGTCTTACAAATGG + Intergenic
944374484 2:199026022-199026044 GGTACACATGGACATACAAAGGG + Intergenic
944729515 2:202502978-202503000 GCTACAGATGGTCTTACAAATGG + Intronic
945845044 2:214933850-214933872 GGTACAGATGTCTTATCAAATGG + Intronic
948386637 2:237584846-237584868 GGTACAGATCTCCTTGCTAATGG + Intronic
1168905218 20:1397896-1397918 GGTACAGATGTTTCTGCAACTGG - Intergenic
1171561425 20:26129996-26130018 GATACAGACATGCCTACAAAGGG + Intergenic
1172340966 20:34157309-34157331 GCTACAGATGGTCTTACAAATGG + Intergenic
1172489890 20:35327686-35327708 GGTTCAGATATCCCTTAAAATGG + Intronic
1173299134 20:41785041-41785063 GGTACAGATGACCCTACTCCCGG + Intergenic
1175507189 20:59494316-59494338 GGTACAGATATACCCACAGATGG + Intergenic
1175672453 20:60917149-60917171 TTTACAGATGTCCTCACAAAGGG + Intergenic
1176649824 21:9535298-9535320 GATACAGACATGCCTACAAAGGG - Intergenic
950623419 3:14226117-14226139 GGTACAGATGTTTCTGCAATTGG - Intergenic
951021072 3:17781427-17781449 GCTACAGATGGTCTTACAAATGG + Intronic
951239916 3:20275507-20275529 GCTACAGATGGTCTTACAAATGG + Intergenic
951303874 3:21033834-21033856 AGTACAGCTGTCTCTACAGATGG + Intergenic
952453577 3:33453051-33453073 GCTACAGATGGTCTTACAAATGG + Intergenic
952554767 3:34519622-34519644 GCTACAGATGGTCTTACAAATGG - Intergenic
952940338 3:38439305-38439327 GCTACAGATGGCCTTACAAATGG - Intergenic
953622399 3:44544257-44544279 GCTACAGATGGTCTTACAAATGG - Intergenic
953804136 3:46053417-46053439 GGTACAGATGTTTCTGCAACTGG + Intergenic
953846090 3:46427611-46427633 GGTACAGATGTTTCTGCAACTGG - Intergenic
954599363 3:51856019-51856041 GCTACAGATGGTCTTACAAATGG + Intergenic
955728686 3:61960349-61960371 GATACAGATGGCCTAACAAAGGG - Intronic
956842507 3:73153627-73153649 GCTACAGATGGTCTTACAAATGG - Intergenic
959474759 3:106796222-106796244 GGTACACATGGCCATACAATGGG + Intergenic
961779621 3:129314098-129314120 CTAACAGATGTCCCTAAAAATGG - Intergenic
963021685 3:140878146-140878168 GCTACAGATGGTCTTACAAATGG + Intergenic
963697289 3:148577369-148577391 GCTACAGATGGTCTTACAAATGG + Intergenic
964223592 3:154371919-154371941 GGTACAAATGGTCTTACAAATGG + Intronic
964540812 3:157777591-157777613 GCTAAAGATGTCCCTACAGTTGG + Intergenic
965139754 3:164818076-164818098 GCTACAGATGGTCTTACAAATGG + Intergenic
969579519 4:8056241-8056263 AGTACAGGTGTACCTACAAATGG + Intronic
969882322 4:10185091-10185113 GGTGGAAATGTCCCTGCAAAGGG - Intergenic
970563332 4:17305146-17305168 GGTACACATGGACATACAAAAGG - Intergenic
970848734 4:20575734-20575756 GGTACAGCTTTCCTTACATAAGG - Intronic
971578990 4:28309617-28309639 GCTACAGATGGTCTTACAAATGG + Intergenic
972132864 4:35859662-35859684 GCTACAGATGGTCGTACAAATGG - Intergenic
972651402 4:41021125-41021147 GCTACAGATGGTCTTACAAATGG + Intronic
974527402 4:63061520-63061542 GCTACAGATGGTCTTACAAATGG + Intergenic
974838345 4:67276002-67276024 GCTACAGATGGTCTTACAAATGG - Intergenic
975595310 4:76044054-76044076 GCTACAGATGGTCTTACAAATGG - Intronic
976174049 4:82334528-82334550 GCTACAGATGGTCTTACAAATGG - Intergenic
977640725 4:99355478-99355500 GCTACAGATGGTCTTACAAATGG + Intergenic
977885047 4:102244651-102244673 GCTACAGATGGTCTTACAAATGG + Intergenic
978047203 4:104144865-104144887 GGTACACATGGACATACAAAGGG - Intergenic
982701673 4:158664598-158664620 GCTACAGATGGTCTTACAAATGG + Intergenic
982824254 4:159982302-159982324 GGTACACATGTGCCTACAGAGGG - Intergenic
983084621 4:163427892-163427914 GCTACAGATGGTCTTACAAATGG + Intergenic
983102289 4:163639736-163639758 GGAATAGATTTCTCTACAAATGG + Intronic
983254007 4:165378726-165378748 GGAATAGATGTCCCTTTAAAAGG + Intronic
984917985 4:184740809-184740831 GCTACAGATGGTCTTACAAATGG + Intergenic
984939051 4:184915690-184915712 GCTACAGATGGTCTTACAAATGG - Intergenic
986656898 5:10021615-10021637 GGCACAGATGTACATCCAAAAGG + Intergenic
987818704 5:22934648-22934670 GCTACAGATGGTCTTACAAATGG + Intergenic
987818905 5:22936362-22936384 GCTACAGATGGTCTTACAAATGG - Intergenic
987948822 5:24650454-24650476 GGTACAGATGTTTCTACAAATGG - Intergenic
988358332 5:30204431-30204453 GCTACAGATGGTCTTACAAATGG + Intergenic
988591496 5:32553527-32553549 GCTACAGATGGTCTTACAAACGG - Intronic
988605307 5:32673850-32673872 GCTACAGATGGTCTTACAAATGG - Intergenic
989496671 5:42117008-42117030 GCTACAGATGGTCTTACAAATGG + Intergenic
989957817 5:50376426-50376448 GCTACAGATGGTCTTACAAATGG + Intergenic
990117143 5:52403065-52403087 GCTACAGATGGTCTTACAAATGG + Intergenic
990367378 5:55084899-55084921 GCTACAGATGGTCTTACAAATGG - Intergenic
990419472 5:55617364-55617386 GCTACAGATGGTCTTACAAATGG + Intergenic
992050246 5:72934876-72934898 GCTACAGATGGTCTTACAAATGG + Intergenic
994230874 5:97309646-97309668 GTTACAGATGGTCTTACAAATGG - Intergenic
995582939 5:113619705-113619727 GCTACAGATGGTCTTACAAATGG - Intergenic
996681083 5:126228728-126228750 GCTACAGATGGTCTTACAAAGGG + Intergenic
997073169 5:130641598-130641620 GCTACAGATGATCTTACAAATGG + Intergenic
997939537 5:138144486-138144508 GGCACAGATGTCGATCCAAATGG - Intronic
998112209 5:139511042-139511064 GCTACAGATGGTCTTACAAATGG + Intergenic
998915509 5:147007068-147007090 GCTACAGATGGTCTTACAAATGG + Intronic
999118392 5:149185496-149185518 GCTGCAGATCTCCCTACAAAAGG - Intronic
1000676927 5:164132619-164132641 GGTATTGATGTCCCCACACAGGG + Intergenic
1003806092 6:9727360-9727382 GCTACAGATGGTCTTACAAATGG + Intronic
1004532193 6:16463885-16463907 GCTACAGATGGTCTTACAAATGG + Intronic
1005546161 6:26874544-26874566 TATACAGATGTCCCTACCAGGGG - Intergenic
1006222146 6:32500362-32500384 GCTACAGATGGTCTTACAAATGG + Intergenic
1007030757 6:38623812-38623834 GCTACAGATGGTCTTACAAATGG + Intronic
1009471299 6:64030766-64030788 GCTACAGATGGTCTTACAAATGG + Intronic
1009873060 6:69472676-69472698 GCTACAGATGGTCTTACAAATGG + Intergenic
1010075374 6:71791572-71791594 GCTACAGATGGTCTTACAAATGG + Intergenic
1010270261 6:73909584-73909606 GCTACAGATGGTCTTACAAATGG + Intergenic
1011374201 6:86672734-86672756 GCTACAGATGGTCTTACAAATGG - Intergenic
1013111317 6:107067559-107067581 GGTACACATGTCCCTTCCCAGGG - Exonic
1013593748 6:111643206-111643228 CTTACAGATGTCCATAAAAAGGG + Intergenic
1013906988 6:115232523-115232545 GCTACAGATGGTCTTACAAATGG - Intergenic
1013977727 6:116096089-116096111 GCTACAGATGGTCTTACAAATGG + Intergenic
1014203103 6:118625881-118625903 GCTACAAATGGCCTTACAAATGG + Intronic
1016677948 6:146793563-146793585 GCTACAGATGGTCTTACAAATGG - Intronic
1017101825 6:150855677-150855699 GCTACAGATGGTCTTACAAATGG + Intergenic
1017402568 6:154081101-154081123 AGCACAGATGTCCAAACAAAAGG + Intronic
1021756197 7:23855390-23855412 GCTACAGATGGTCTTACAAATGG - Intergenic
1023077675 7:36499897-36499919 GCTACAGATGGTCTTACAAATGG - Intergenic
1024870153 7:53955569-53955591 GCTACAGATGGTCTTACAAATGG - Intergenic
1025276405 7:57585380-57585402 GATACAGACATGCCTACAAAGGG - Intergenic
1026546395 7:71326749-71326771 GATACAGCTGTCACTAGAAAAGG - Intronic
1028494378 7:91447707-91447729 GCTACAGATGGTCTTACAAATGG - Intergenic
1028925789 7:96355695-96355717 GGGCCAGAGGCCCCTACAAAAGG + Intergenic
1030420783 7:109304081-109304103 GCTACAGATGGTCTTACAAATGG + Intergenic
1031011244 7:116526515-116526537 TGTAGAGATGTCCCTGCAGAGGG - Exonic
1032722806 7:134564613-134564635 GCTACAGATGGTCTTACAAATGG + Exonic
1032941837 7:136802582-136802604 GGGACAGATGTAGCTACACAGGG - Intergenic
1033758720 7:144418665-144418687 GCTACAGATGGTCTTACAAATGG - Intergenic
1034579336 7:152028879-152028901 GCTACAGATGGTCTTACAAATGG - Intronic
1035836279 8:2755982-2756004 GGTACACATGGCCCCAAAAAAGG - Intergenic
1038430088 8:27493080-27493102 GCTACAGATGGTCTTACAAATGG - Intronic
1038639276 8:29311058-29311080 GCTACAGATGGTCTTACAAATGG + Intergenic
1038992165 8:32879557-32879579 AGCAGAGATGTTCCTACAAAGGG - Intergenic
1039162151 8:34634264-34634286 AACACAGATGTCCCTACAACAGG + Intergenic
1039276506 8:35938616-35938638 GCTACAGATGGTCTTACAAATGG + Intergenic
1039305349 8:36255964-36255986 GCTACATATGTCCCTCCAAAAGG + Intergenic
1039998950 8:42560439-42560461 GCTACAGATGGTCTTACAAATGG - Intergenic
1040649785 8:49434782-49434804 GCTACAGATGGTCTTACAAATGG + Intergenic
1040667343 8:49650384-49650406 GCTACAGATGGTCTTACAAATGG - Intergenic
1040970933 8:53137109-53137131 GCTACAGATGGCCTTACAAATGG - Intergenic
1042920302 8:73913363-73913385 GCTACAGATGGTCTTACAAATGG + Intergenic
1044456112 8:92394307-92394329 GCTACAGATGGTCTTACAAATGG - Intergenic
1044500569 8:92950364-92950386 TGTACATATGTACATACAAAAGG + Intronic
1044722898 8:95167917-95167939 GGCACAGATGTCTTTTCAAAGGG - Intergenic
1045096101 8:98800189-98800211 GCTACAGATGGTCTTACAAATGG + Intronic
1045587841 8:103559290-103559312 GGAAGAGATGTCCCTGCTAATGG - Intronic
1045858848 8:106793394-106793416 GCTACAGATGGTCTTACAAATGG + Intergenic
1046455893 8:114460517-114460539 GGTACACATGGACCTAAAAAAGG - Intergenic
1047607588 8:126490353-126490375 GGTACAGAGGTCCCTGAAAGAGG + Intergenic
1047808456 8:128382196-128382218 GCTACAGATGGCCTTACAAATGG + Intergenic
1047858650 8:128939991-128940013 GAAACAGATGTGCCTTCAAAGGG - Intergenic
1048911898 8:139143143-139143165 GCTACAGAAGTCCCTTCAACAGG - Intergenic
1049877590 8:145035652-145035674 GCTACAGATGGACTTACAAATGG + Intergenic
1050361603 9:4836073-4836095 GGTAAAGATGTGCCTTCACAGGG + Intronic
1051935736 9:22440631-22440653 GCTACAGATGGTCTTACAAATGG + Intergenic
1052290043 9:26830028-26830050 GCTACAGATGGTCTTACAAATGG + Intergenic
1053502279 9:38608878-38608900 GGTACAGATGTGATAACAAAAGG + Intergenic
1055457886 9:76489945-76489967 GCTACAGATGATCTTACAAATGG - Intronic
1057153759 9:92820420-92820442 GGTACAGATGTGATAACAAAAGG - Intergenic
1057681677 9:97193325-97193347 GGTACAGATGTGATAACAAAAGG + Intergenic
1060962881 9:127693571-127693593 GAGACAGAAGTCCCTACAAAGGG - Intronic
1062185663 9:135217006-135217028 GGTACAGATGGCCTTTCCAATGG + Intergenic
1203627566 Un_KI270750v1:38846-38868 GATACAGACATGCCTACAAAGGG - Intergenic
1186727743 X:12375081-12375103 GCTACAGATGTCACTGCAAATGG - Intronic
1186952519 X:14642907-14642929 GGTACAGTTGACCCTAAAATAGG + Intronic
1187049325 X:15680255-15680277 AGTATAGACATCCCTACAAATGG + Intergenic
1188098095 X:26046990-26047012 GCTACAGATGGTCTTACAAATGG + Intergenic
1188137043 X:26504101-26504123 GCTACAGATGGTCTTACAAATGG + Intergenic
1189758535 X:44297358-44297380 GGTATATATGTCTCTCCAAATGG - Intronic
1190722632 X:53162753-53162775 GGTACAGATGTTTCTGCAATTGG + Intergenic
1191139717 X:57104047-57104069 GGTACAGATGTTTCTGCAATTGG - Intergenic
1192482210 X:71495283-71495305 GCTACAGATGGTCTTACAAATGG - Intronic
1192869794 X:75174366-75174388 GCTACAGATGGTCTTACAAATGG - Intergenic
1194011731 X:88569976-88569998 GGTACAGGTGTATCTACATATGG + Intergenic
1195440836 X:104896269-104896291 GCTACAGATGGTCTTACAAATGG + Intronic
1195552003 X:106181813-106181835 GCTACAGATGGTCTTACAAATGG - Intronic
1195850639 X:109278370-109278392 GCTACAGATGGTCTTACAAATGG - Intergenic
1196489575 X:116250318-116250340 GCTACAGATGGTCTTACAAATGG + Intergenic
1197000418 X:121432293-121432315 GCTACAGATGGTCTTACAAATGG - Intergenic
1199831900 X:151555874-151555896 GCTACAGATGGTCTTACAAATGG - Intergenic
1200413676 Y:2886583-2886605 GGTACAGATGTTTCTGCAATTGG + Intronic
1200776845 Y:7177042-7177064 GCTACAGATGGCCTTACAAATGG + Intergenic
1200960044 Y:8988185-8988207 GCTACAGATGGTCTTACAAATGG + Intergenic
1201271676 Y:12261673-12261695 GGTACAGTTGTTTTTACAAATGG - Intergenic
1201311327 Y:12600506-12600528 GCTACAGATGGTCTTACAAATGG - Intergenic
1201430400 Y:13896830-13896852 GCTACAGATGGTCTTACAAATGG + Intergenic
1201455979 Y:14167165-14167187 GCTACAGATGGTCTTACAAATGG + Intergenic
1201469000 Y:14314083-14314105 GCTACAGATGGTCTTACAAATGG + Intergenic
1201472604 Y:14350778-14350800 GCTACAGATGGTCTTACAAATGG - Intergenic
1201488033 Y:14512407-14512429 GCTACAGATGGCCTTACACATGG + Intergenic
1201495822 Y:14590553-14590575 GCTACAGATGGTCTTACAAATGG - Intronic
1201515374 Y:14814413-14814435 GCTACAGATGGTCTTACAAATGG - Intronic
1201556214 Y:15266890-15266912 GTTACAGATGTTCTTACAAATGG + Intergenic
1201572906 Y:15433436-15433458 GCTACAGATGGTCTTACAAATGG + Intergenic
1201729128 Y:17186353-17186375 GGTGCAGATGGTCTTACAAATGG - Intergenic
1201907548 Y:19101030-19101052 GCTACAGATGCTCTTACAAATGG - Intergenic
1201919788 Y:19222032-19222054 GCTACAGATGGTCTTACAAATGG + Intergenic
1201989283 Y:20007125-20007147 GCTACAGATGGTCTTACAAATGG - Intergenic
1202243655 Y:22794647-22794669 GCTACAGATGGTCTTACAAATGG + Intergenic
1202396642 Y:24428397-24428419 GCTACAGATGGTCTTACAAATGG + Intergenic
1202474141 Y:25241695-25241717 GCTACAGATGGTCTTACAAATGG - Intergenic