ID: 1154070981

View in Genome Browser
Species Human (GRCh38)
Location 18:11150691-11150713
Sequence GACTCAAGACAGTTGGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154070979_1154070981 -4 Left 1154070979 18:11150672-11150694 CCATTGCTTTTTGAATGAAGACT No data
Right 1154070981 18:11150691-11150713 GACTCAAGACAGTTGGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154070981 Original CRISPR GACTCAAGACAGTTGGCATA TGG Intergenic
No off target data available for this crispr