ID: 1154072035

View in Genome Browser
Species Human (GRCh38)
Location 18:11161506-11161528
Sequence CCATAGGCACAAAGATAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154072031_1154072035 -9 Left 1154072031 18:11161492-11161514 CCCTTGACAGTCATCCATAGGCA No data
Right 1154072035 18:11161506-11161528 CCATAGGCACAAAGATAAGGTGG No data
1154072032_1154072035 -10 Left 1154072032 18:11161493-11161515 CCTTGACAGTCATCCATAGGCAC No data
Right 1154072035 18:11161506-11161528 CCATAGGCACAAAGATAAGGTGG No data
1154072028_1154072035 24 Left 1154072028 18:11161459-11161481 CCATTAGCAATGCAGTTCCTAGA No data
Right 1154072035 18:11161506-11161528 CCATAGGCACAAAGATAAGGTGG No data
1154072029_1154072035 7 Left 1154072029 18:11161476-11161498 CCTAGAGAAAATGTTTCCCTTGA No data
Right 1154072035 18:11161506-11161528 CCATAGGCACAAAGATAAGGTGG No data
1154072027_1154072035 25 Left 1154072027 18:11161458-11161480 CCCATTAGCAATGCAGTTCCTAG No data
Right 1154072035 18:11161506-11161528 CCATAGGCACAAAGATAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154072035 Original CRISPR CCATAGGCACAAAGATAAGG TGG Intergenic
No off target data available for this crispr