ID: 1154073141

View in Genome Browser
Species Human (GRCh38)
Location 18:11173509-11173531
Sequence ATAGAGAAAAAGGCTGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154073137_1154073141 5 Left 1154073137 18:11173481-11173503 CCTATTTTACATGTTTACTTTCA No data
Right 1154073141 18:11173509-11173531 ATAGAGAAAAAGGCTGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154073141 Original CRISPR ATAGAGAAAAAGGCTGGGCA CGG Intergenic
No off target data available for this crispr