ID: 1154079557

View in Genome Browser
Species Human (GRCh38)
Location 18:11242929-11242951
Sequence ACCAGTGTGGAGTGCTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154079547_1154079557 23 Left 1154079547 18:11242883-11242905 CCAGCAGAGTAAGGAGCACAGAG No data
Right 1154079557 18:11242929-11242951 ACCAGTGTGGAGTGCTCCCAGGG No data
1154079546_1154079557 24 Left 1154079546 18:11242882-11242904 CCCAGCAGAGTAAGGAGCACAGA No data
Right 1154079557 18:11242929-11242951 ACCAGTGTGGAGTGCTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154079557 Original CRISPR ACCAGTGTGGAGTGCTCCCA GGG Intergenic
No off target data available for this crispr