ID: 1154083707 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:11281621-11281643 |
| Sequence | GAGGTCTTTGGAAGGTGATT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1154083701_1154083707 | -4 | Left | 1154083701 | 18:11281602-11281624 | CCCTACACCTTCTGGAGGTGAGG | No data | ||
| Right | 1154083707 | 18:11281621-11281643 | GAGGTCTTTGGAAGGTGATTAGG | No data | ||||
| 1154083703_1154083707 | -5 | Left | 1154083703 | 18:11281603-11281625 | CCTACACCTTCTGGAGGTGAGGT | No data | ||
| Right | 1154083707 | 18:11281621-11281643 | GAGGTCTTTGGAAGGTGATTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1154083707 | Original CRISPR | GAGGTCTTTGGAAGGTGATT AGG | Intergenic | ||
| No off target data available for this crispr | |||||