ID: 1154083708

View in Genome Browser
Species Human (GRCh38)
Location 18:11281632-11281654
Sequence AAGGTGATTAGGATTAGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154083703_1154083708 6 Left 1154083703 18:11281603-11281625 CCTACACCTTCTGGAGGTGAGGT No data
Right 1154083708 18:11281632-11281654 AAGGTGATTAGGATTAGCTGAGG No data
1154083701_1154083708 7 Left 1154083701 18:11281602-11281624 CCCTACACCTTCTGGAGGTGAGG No data
Right 1154083708 18:11281632-11281654 AAGGTGATTAGGATTAGCTGAGG No data
1154083704_1154083708 0 Left 1154083704 18:11281609-11281631 CCTTCTGGAGGTGAGGTCTTTGG No data
Right 1154083708 18:11281632-11281654 AAGGTGATTAGGATTAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154083708 Original CRISPR AAGGTGATTAGGATTAGCTG AGG Intergenic
No off target data available for this crispr