ID: 1154089615

View in Genome Browser
Species Human (GRCh38)
Location 18:11344756-11344778
Sequence TCCCAGATGGGGCAGCAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8588
Summary {0: 6, 1: 34, 2: 291, 3: 1900, 4: 6357}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154089615_1154089623 15 Left 1154089615 18:11344756-11344778 CCCGGCTGCTGCCCCATCTGGGA 0: 6
1: 34
2: 291
3: 1900
4: 6357
Right 1154089623 18:11344794-11344816 TGCCCAGCAGCCGCCCCGTCTGG No data
1154089615_1154089624 16 Left 1154089615 18:11344756-11344778 CCCGGCTGCTGCCCCATCTGGGA 0: 6
1: 34
2: 291
3: 1900
4: 6357
Right 1154089624 18:11344795-11344817 GCCCAGCAGCCGCCCCGTCTGGG 0: 46
1: 352
2: 1296
3: 3454
4: 4317
1154089615_1154089627 24 Left 1154089615 18:11344756-11344778 CCCGGCTGCTGCCCCATCTGGGA 0: 6
1: 34
2: 291
3: 1900
4: 6357
Right 1154089627 18:11344803-11344825 GCCGCCCCGTCTGGGAAGTGAGG 0: 520
1: 5595
2: 10717
3: 6810
4: 4127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154089615 Original CRISPR TCCCAGATGGGGCAGCAGCC GGG (reversed) Intergenic
Too many off-targets to display for this crispr