ID: 1154090860 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:11361678-11361700 |
Sequence | CTCCCCAGTTCAGGTATATT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1154090860_1154090863 | -8 | Left | 1154090860 | 18:11361678-11361700 | CCAAATATACCTGAACTGGGGAG | No data | ||
Right | 1154090863 | 18:11361693-11361715 | CTGGGGAGTGGAAAAACAATTGG | No data | ||||
1154090860_1154090864 | 11 | Left | 1154090860 | 18:11361678-11361700 | CCAAATATACCTGAACTGGGGAG | No data | ||
Right | 1154090864 | 18:11361712-11361734 | TTGGCTGTACGTCCATAAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1154090860 | Original CRISPR | CTCCCCAGTTCAGGTATATT TGG (reversed) | Intergenic | ||