ID: 1154090860

View in Genome Browser
Species Human (GRCh38)
Location 18:11361678-11361700
Sequence CTCCCCAGTTCAGGTATATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154090860_1154090863 -8 Left 1154090860 18:11361678-11361700 CCAAATATACCTGAACTGGGGAG No data
Right 1154090863 18:11361693-11361715 CTGGGGAGTGGAAAAACAATTGG No data
1154090860_1154090864 11 Left 1154090860 18:11361678-11361700 CCAAATATACCTGAACTGGGGAG No data
Right 1154090864 18:11361712-11361734 TTGGCTGTACGTCCATAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154090860 Original CRISPR CTCCCCAGTTCAGGTATATT TGG (reversed) Intergenic