ID: 1154093637

View in Genome Browser
Species Human (GRCh38)
Location 18:11388893-11388915
Sequence GCATATGCATGTCTGTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154093633_1154093637 25 Left 1154093633 18:11388845-11388867 CCCATCACTTCCTTTTTTTCTCA No data
Right 1154093637 18:11388893-11388915 GCATATGCATGTCTGTGCTGAGG No data
1154093635_1154093637 15 Left 1154093635 18:11388855-11388877 CCTTTTTTTCTCACCTTCTCACA No data
Right 1154093637 18:11388893-11388915 GCATATGCATGTCTGTGCTGAGG No data
1154093636_1154093637 2 Left 1154093636 18:11388868-11388890 CCTTCTCACATGCAAAAACACAT No data
Right 1154093637 18:11388893-11388915 GCATATGCATGTCTGTGCTGAGG No data
1154093634_1154093637 24 Left 1154093634 18:11388846-11388868 CCATCACTTCCTTTTTTTCTCAC No data
Right 1154093637 18:11388893-11388915 GCATATGCATGTCTGTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154093637 Original CRISPR GCATATGCATGTCTGTGCTG AGG Intergenic
No off target data available for this crispr