ID: 1154093777

View in Genome Browser
Species Human (GRCh38)
Location 18:11390759-11390781
Sequence CAGTCCTTGTATATACTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154093775_1154093777 25 Left 1154093775 18:11390711-11390733 CCTCTCAGAGCACCTATTTTCTC 0: 1
1: 0
2: 2
3: 50
4: 406
Right 1154093777 18:11390759-11390781 CAGTCCTTGTATATACTGATAGG No data
1154093776_1154093777 13 Left 1154093776 18:11390723-11390745 CCTATTTTCTCATCTAAAAAATA 0: 1
1: 6
2: 52
3: 396
4: 2041
Right 1154093777 18:11390759-11390781 CAGTCCTTGTATATACTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154093777 Original CRISPR CAGTCCTTGTATATACTGAT AGG Intergenic
No off target data available for this crispr