ID: 1154094634

View in Genome Browser
Species Human (GRCh38)
Location 18:11401047-11401069
Sequence TGTTAGTTAGCTACCTTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154094633_1154094634 -3 Left 1154094633 18:11401027-11401049 CCGTGAAATGAGTTTATCTGTGT No data
Right 1154094634 18:11401047-11401069 TGTTAGTTAGCTACCTTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154094634 Original CRISPR TGTTAGTTAGCTACCTTGTG AGG Intergenic
No off target data available for this crispr