ID: 1154099028

View in Genome Browser
Species Human (GRCh38)
Location 18:11451488-11451510
Sequence CTCTTTAAGTTGAAGTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154099026_1154099028 -1 Left 1154099026 18:11451466-11451488 CCTGAAGAACTTCTTTTACCATC No data
Right 1154099028 18:11451488-11451510 CTCTTTAAGTTGAAGTCTGATGG No data
1154099025_1154099028 6 Left 1154099025 18:11451459-11451481 CCTACAACCTGAAGAACTTCTTT No data
Right 1154099028 18:11451488-11451510 CTCTTTAAGTTGAAGTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154099028 Original CRISPR CTCTTTAAGTTGAAGTCTGA TGG Intergenic
No off target data available for this crispr