ID: 1154099975

View in Genome Browser
Species Human (GRCh38)
Location 18:11463890-11463912
Sequence CAGAAGAATGAGTATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154099975_1154099977 -2 Left 1154099975 18:11463890-11463912 CCTTCCTCATACTCATTCTTCTG No data
Right 1154099977 18:11463911-11463933 TGTTAATGAGCCAATCAGCTTGG No data
1154099975_1154099979 12 Left 1154099975 18:11463890-11463912 CCTTCCTCATACTCATTCTTCTG No data
Right 1154099979 18:11463925-11463947 TCAGCTTGGTTTTTAAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154099975 Original CRISPR CAGAAGAATGAGTATGAGGA AGG (reversed) Intergenic
No off target data available for this crispr