ID: 1154106096

View in Genome Browser
Species Human (GRCh38)
Location 18:11524430-11524452
Sequence GGATTGATGCCTGAAAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154106096_1154106101 -9 Left 1154106096 18:11524430-11524452 CCAGCATTTTCAGGCATCAATCC No data
Right 1154106101 18:11524444-11524466 CATCAATCCGGGGGCTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154106096 Original CRISPR GGATTGATGCCTGAAAATGC TGG (reversed) Intergenic
No off target data available for this crispr