ID: 1154106265

View in Genome Browser
Species Human (GRCh38)
Location 18:11526439-11526461
Sequence TTGGGCTCAAGAGATGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154106258_1154106265 28 Left 1154106258 18:11526388-11526410 CCCAGGCTGGAGTGCAGTGGCGT 0: 20980
1: 129116
2: 240855
3: 208608
4: 116024
Right 1154106265 18:11526439-11526461 TTGGGCTCAAGAGATGCCTGGGG No data
1154106259_1154106265 27 Left 1154106259 18:11526389-11526411 CCAGGCTGGAGTGCAGTGGCGTG 0: 22044
1: 109955
2: 188319
3: 217928
4: 158300
Right 1154106265 18:11526439-11526461 TTGGGCTCAAGAGATGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154106265 Original CRISPR TTGGGCTCAAGAGATGCCTG GGG Intergenic
No off target data available for this crispr