ID: 1154107438

View in Genome Browser
Species Human (GRCh38)
Location 18:11534536-11534558
Sequence CCTGCAGAGACTGCAGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154107438_1154107446 8 Left 1154107438 18:11534536-11534558 CCTTCTCCTGCAGTCTCTGCAGG No data
Right 1154107446 18:11534567-11534589 CTCCTGCTGGCGCTTCAGCCAGG No data
1154107438_1154107442 -5 Left 1154107438 18:11534536-11534558 CCTTCTCCTGCAGTCTCTGCAGG No data
Right 1154107442 18:11534554-11534576 GCAGGGCACCCTCCTCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154107438 Original CRISPR CCTGCAGAGACTGCAGGAGA AGG (reversed) Intergenic
No off target data available for this crispr