ID: 1154108457

View in Genome Browser
Species Human (GRCh38)
Location 18:11545806-11545828
Sequence CTGTTTCTGGTCCAAGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154108457_1154108463 -1 Left 1154108457 18:11545806-11545828 CCAGACACTTGGACCAGAAACAG No data
Right 1154108463 18:11545828-11545850 GTTAGGTCGGTGGTGGAGTCAGG No data
1154108457_1154108462 -8 Left 1154108457 18:11545806-11545828 CCAGACACTTGGACCAGAAACAG No data
Right 1154108462 18:11545821-11545843 AGAAACAGTTAGGTCGGTGGTGG No data
1154108457_1154108464 20 Left 1154108457 18:11545806-11545828 CCAGACACTTGGACCAGAAACAG No data
Right 1154108464 18:11545849-11545871 GGCAAAGTGAAATCATCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154108457 Original CRISPR CTGTTTCTGGTCCAAGTGTC TGG (reversed) Intergenic
No off target data available for this crispr