ID: 1154108590

View in Genome Browser
Species Human (GRCh38)
Location 18:11546994-11547016
Sequence GCCTCCTGATTGGCCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154108584_1154108590 8 Left 1154108584 18:11546963-11546985 CCTCAATCTTCAGCCTTGTGTAG No data
Right 1154108590 18:11546994-11547016 GCCTCCTGATTGGCCAGAGCAGG No data
1154108587_1154108590 -5 Left 1154108587 18:11546976-11546998 CCTTGTGTAGACTGGCCGGCCTC No data
Right 1154108590 18:11546994-11547016 GCCTCCTGATTGGCCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154108590 Original CRISPR GCCTCCTGATTGGCCAGAGC AGG Intergenic
No off target data available for this crispr