ID: 1154111017

View in Genome Browser
Species Human (GRCh38)
Location 18:11568414-11568436
Sequence TGACCTGGTGGCCCACGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154111017_1154111024 30 Left 1154111017 18:11568414-11568436 CCTCTTCGTGGGCCACCAGGTCA No data
Right 1154111024 18:11568467-11568489 GTGCAGGTCAGCTCATATACAGG No data
1154111017_1154111021 14 Left 1154111017 18:11568414-11568436 CCTCTTCGTGGGCCACCAGGTCA No data
Right 1154111021 18:11568451-11568473 CCATGCCACCTGTGCTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154111017 Original CRISPR TGACCTGGTGGCCCACGAAG AGG (reversed) Intergenic