ID: 1154111019

View in Genome Browser
Species Human (GRCh38)
Location 18:11568429-11568451
Sequence GTGTGTCAAAGCAGATGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154111019_1154111024 15 Left 1154111019 18:11568429-11568451 CCAGGTCATCTGCTTTGACACAC No data
Right 1154111024 18:11568467-11568489 GTGCAGGTCAGCTCATATACAGG No data
1154111019_1154111021 -1 Left 1154111019 18:11568429-11568451 CCAGGTCATCTGCTTTGACACAC No data
Right 1154111021 18:11568451-11568473 CCATGCCACCTGTGCTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154111019 Original CRISPR GTGTGTCAAAGCAGATGACC TGG (reversed) Intergenic