ID: 1154111020

View in Genome Browser
Species Human (GRCh38)
Location 18:11568451-11568473
Sequence CCTGCACAGCACAGGTGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154111020_1154111024 -7 Left 1154111020 18:11568451-11568473 CCATGCCACCTGTGCTGTGCAGG No data
Right 1154111024 18:11568467-11568489 GTGCAGGTCAGCTCATATACAGG No data
1154111020_1154111026 25 Left 1154111020 18:11568451-11568473 CCATGCCACCTGTGCTGTGCAGG No data
Right 1154111026 18:11568499-11568521 TTCTGTCTTTCAACCAAGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154111020 Original CRISPR CCTGCACAGCACAGGTGGCA TGG (reversed) Intergenic