ID: 1154111021

View in Genome Browser
Species Human (GRCh38)
Location 18:11568451-11568473
Sequence CCATGCCACCTGTGCTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154111013_1154111021 23 Left 1154111013 18:11568405-11568427 CCAGCCCTTCCTCTTCGTGGGCC No data
Right 1154111021 18:11568451-11568473 CCATGCCACCTGTGCTGTGCAGG No data
1154111017_1154111021 14 Left 1154111017 18:11568414-11568436 CCTCTTCGTGGGCCACCAGGTCA No data
Right 1154111021 18:11568451-11568473 CCATGCCACCTGTGCTGTGCAGG No data
1154111014_1154111021 19 Left 1154111014 18:11568409-11568431 CCCTTCCTCTTCGTGGGCCACCA No data
Right 1154111021 18:11568451-11568473 CCATGCCACCTGTGCTGTGCAGG No data
1154111019_1154111021 -1 Left 1154111019 18:11568429-11568451 CCAGGTCATCTGCTTTGACACAC No data
Right 1154111021 18:11568451-11568473 CCATGCCACCTGTGCTGTGCAGG No data
1154111018_1154111021 2 Left 1154111018 18:11568426-11568448 CCACCAGGTCATCTGCTTTGACA No data
Right 1154111021 18:11568451-11568473 CCATGCCACCTGTGCTGTGCAGG No data
1154111015_1154111021 18 Left 1154111015 18:11568410-11568432 CCTTCCTCTTCGTGGGCCACCAG No data
Right 1154111021 18:11568451-11568473 CCATGCCACCTGTGCTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154111021 Original CRISPR CCATGCCACCTGTGCTGTGC AGG Intergenic