ID: 1154111024

View in Genome Browser
Species Human (GRCh38)
Location 18:11568467-11568489
Sequence GTGCAGGTCAGCTCATATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154111018_1154111024 18 Left 1154111018 18:11568426-11568448 CCACCAGGTCATCTGCTTTGACA No data
Right 1154111024 18:11568467-11568489 GTGCAGGTCAGCTCATATACAGG No data
1154111020_1154111024 -7 Left 1154111020 18:11568451-11568473 CCATGCCACCTGTGCTGTGCAGG No data
Right 1154111024 18:11568467-11568489 GTGCAGGTCAGCTCATATACAGG No data
1154111019_1154111024 15 Left 1154111019 18:11568429-11568451 CCAGGTCATCTGCTTTGACACAC No data
Right 1154111024 18:11568467-11568489 GTGCAGGTCAGCTCATATACAGG No data
1154111017_1154111024 30 Left 1154111017 18:11568414-11568436 CCTCTTCGTGGGCCACCAGGTCA No data
Right 1154111024 18:11568467-11568489 GTGCAGGTCAGCTCATATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154111024 Original CRISPR GTGCAGGTCAGCTCATATAC AGG Intergenic