ID: 1154111565

View in Genome Browser
Species Human (GRCh38)
Location 18:11572865-11572887
Sequence TTTCTACTGTCCCTAAACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154111560_1154111565 28 Left 1154111560 18:11572814-11572836 CCATCAGCAATGGACCTGAACAG No data
Right 1154111565 18:11572865-11572887 TTTCTACTGTCCCTAAACTCAGG No data
1154111559_1154111565 29 Left 1154111559 18:11572813-11572835 CCCATCAGCAATGGACCTGAACA No data
Right 1154111565 18:11572865-11572887 TTTCTACTGTCCCTAAACTCAGG No data
1154111563_1154111565 1 Left 1154111563 18:11572841-11572863 CCTCCATGATCTCTCATGGTGTT No data
Right 1154111565 18:11572865-11572887 TTTCTACTGTCCCTAAACTCAGG No data
1154111564_1154111565 -2 Left 1154111564 18:11572844-11572866 CCATGATCTCTCATGGTGTTGTT No data
Right 1154111565 18:11572865-11572887 TTTCTACTGTCCCTAAACTCAGG No data
1154111561_1154111565 14 Left 1154111561 18:11572828-11572850 CCTGAACAGTTCTCCTCCATGAT No data
Right 1154111565 18:11572865-11572887 TTTCTACTGTCCCTAAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154111565 Original CRISPR TTTCTACTGTCCCTAAACTC AGG Intergenic
No off target data available for this crispr