ID: 1154115454

View in Genome Browser
Species Human (GRCh38)
Location 18:11609715-11609737
Sequence GCTGGTGGCCCTGCTGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154115436_1154115454 30 Left 1154115436 18:11609662-11609684 CCCAGCCTCCACTGGCACCAGCG 0: 1
1: 1
2: 5
3: 26
4: 254
Right 1154115454 18:11609715-11609737 GCTGGTGGCCCTGCTGGGTGGGG No data
1154115441_1154115454 4 Left 1154115441 18:11609688-11609710 CCAGCCCTCTGATGCCACCAATG No data
Right 1154115454 18:11609715-11609737 GCTGGTGGCCCTGCTGGGTGGGG No data
1154115438_1154115454 25 Left 1154115438 18:11609667-11609689 CCTCCACTGGCACCAGCGCTGCC 0: 1
1: 1
2: 3
3: 69
4: 428
Right 1154115454 18:11609715-11609737 GCTGGTGGCCCTGCTGGGTGGGG No data
1154115437_1154115454 29 Left 1154115437 18:11609663-11609685 CCAGCCTCCACTGGCACCAGCGC 0: 1
1: 1
2: 3
3: 32
4: 353
Right 1154115454 18:11609715-11609737 GCTGGTGGCCCTGCTGGGTGGGG No data
1154115443_1154115454 0 Left 1154115443 18:11609692-11609714 CCCTCTGATGCCACCAATGGCCT No data
Right 1154115454 18:11609715-11609737 GCTGGTGGCCCTGCTGGGTGGGG No data
1154115447_1154115454 -10 Left 1154115447 18:11609702-11609724 CCACCAATGGCCTGCTGGTGGCC No data
Right 1154115454 18:11609715-11609737 GCTGGTGGCCCTGCTGGGTGGGG No data
1154115439_1154115454 22 Left 1154115439 18:11609670-11609692 CCACTGGCACCAGCGCTGCCAGC No data
Right 1154115454 18:11609715-11609737 GCTGGTGGCCCTGCTGGGTGGGG No data
1154115440_1154115454 13 Left 1154115440 18:11609679-11609701 CCAGCGCTGCCAGCCCTCTGATG No data
Right 1154115454 18:11609715-11609737 GCTGGTGGCCCTGCTGGGTGGGG No data
1154115444_1154115454 -1 Left 1154115444 18:11609693-11609715 CCTCTGATGCCACCAATGGCCTG No data
Right 1154115454 18:11609715-11609737 GCTGGTGGCCCTGCTGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154115454 Original CRISPR GCTGGTGGCCCTGCTGGGTG GGG Intergenic
No off target data available for this crispr