ID: 1154115531

View in Genome Browser
Species Human (GRCh38)
Location 18:11610120-11610142
Sequence TGGACTCTGGACACTACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154115524_1154115531 4 Left 1154115524 18:11610093-11610115 CCTAGGACTAATAATCATTGTGG No data
Right 1154115531 18:11610120-11610142 TGGACTCTGGACACTACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154115531 Original CRISPR TGGACTCTGGACACTACAGG AGG Intergenic
No off target data available for this crispr