ID: 1154123684

View in Genome Browser
Species Human (GRCh38)
Location 18:11671611-11671633
Sequence AAACCAGACACCCAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154123684_1154123698 18 Left 1154123684 18:11671611-11671633 CCTGCCTCCTGGGTGTCTGGTTT No data
Right 1154123698 18:11671652-11671674 TGGGGGGCAAGGGACAGCTTTGG No data
1154123684_1154123695 7 Left 1154123684 18:11671611-11671633 CCTGCCTCCTGGGTGTCTGGTTT No data
Right 1154123695 18:11671641-11671663 GGGTCCAGATGTGGGGGGCAAGG No data
1154123684_1154123692 1 Left 1154123684 18:11671611-11671633 CCTGCCTCCTGGGTGTCTGGTTT No data
Right 1154123692 18:11671635-11671657 ATGCCTGGGTCCAGATGTGGGGG No data
1154123684_1154123696 8 Left 1154123684 18:11671611-11671633 CCTGCCTCCTGGGTGTCTGGTTT No data
Right 1154123696 18:11671642-11671664 GGTCCAGATGTGGGGGGCAAGGG No data
1154123684_1154123689 -2 Left 1154123684 18:11671611-11671633 CCTGCCTCCTGGGTGTCTGGTTT No data
Right 1154123689 18:11671632-11671654 TTGATGCCTGGGTCCAGATGTGG No data
1154123684_1154123691 0 Left 1154123684 18:11671611-11671633 CCTGCCTCCTGGGTGTCTGGTTT No data
Right 1154123691 18:11671634-11671656 GATGCCTGGGTCCAGATGTGGGG No data
1154123684_1154123690 -1 Left 1154123684 18:11671611-11671633 CCTGCCTCCTGGGTGTCTGGTTT No data
Right 1154123690 18:11671633-11671655 TGATGCCTGGGTCCAGATGTGGG No data
1154123684_1154123693 2 Left 1154123684 18:11671611-11671633 CCTGCCTCCTGGGTGTCTGGTTT No data
Right 1154123693 18:11671636-11671658 TGCCTGGGTCCAGATGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154123684 Original CRISPR AAACCAGACACCCAGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr