ID: 1154125207

View in Genome Browser
Species Human (GRCh38)
Location 18:11686737-11686759
Sequence GATCACTGAACAACAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154125207_1154125210 16 Left 1154125207 18:11686737-11686759 CCATCCATTGTTGTTCAGTGATC No data
Right 1154125210 18:11686776-11686798 AGATTTGATATACAAATGTGAGG No data
1154125207_1154125211 17 Left 1154125207 18:11686737-11686759 CCATCCATTGTTGTTCAGTGATC No data
Right 1154125211 18:11686777-11686799 GATTTGATATACAAATGTGAGGG No data
1154125207_1154125213 19 Left 1154125207 18:11686737-11686759 CCATCCATTGTTGTTCAGTGATC No data
Right 1154125213 18:11686779-11686801 TTTGATATACAAATGTGAGGGGG No data
1154125207_1154125212 18 Left 1154125207 18:11686737-11686759 CCATCCATTGTTGTTCAGTGATC No data
Right 1154125212 18:11686778-11686800 ATTTGATATACAAATGTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154125207 Original CRISPR GATCACTGAACAACAATGGA TGG (reversed) Intergenic
No off target data available for this crispr