ID: 1154125636

View in Genome Browser
Species Human (GRCh38)
Location 18:11689716-11689738
Sequence CTTCGCCGCCCCGAGGGAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154125636_1154125645 19 Left 1154125636 18:11689716-11689738 CCTGCTCCCTCGGGGCGGCGAAG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1154125645 18:11689758-11689780 GCCCAAAGCAGACAAGCCGAAGG 0: 1
1: 0
2: 0
3: 13
4: 104
1154125636_1154125642 -3 Left 1154125636 18:11689716-11689738 CCTGCTCCCTCGGGGCGGCGAAG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1154125642 18:11689736-11689758 AAGGGAGCCCGGCATGCGCTCGG 0: 1
1: 0
2: 0
3: 3
4: 88
1154125636_1154125648 27 Left 1154125636 18:11689716-11689738 CCTGCTCCCTCGGGGCGGCGAAG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1154125648 18:11689766-11689788 CAGACAAGCCGAAGGAGAAGCGG 0: 1
1: 1
2: 3
3: 19
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154125636 Original CRISPR CTTCGCCGCCCCGAGGGAGC AGG (reversed) Exonic
900310058 1:2029278-2029300 CGCCGCTGCTCCGAGGGAGCTGG + Intronic
901018639 1:6245177-6245199 CATCTCCGCGCCGAAGGAGCTGG - Exonic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
919640176 1:200039031-200039053 CTTCCCAGCCCCGAGGGTGACGG - Intronic
919841240 1:201610942-201610964 CTTCGCCACCCCCAGGGCCCAGG - Intergenic
924589907 1:245393917-245393939 CTTCCCCTCCCCCAGGTAGCTGG - Intronic
1063504013 10:6580170-6580192 CGCCGCCGCCGGGAGGGAGCGGG - Intronic
1071086852 10:81875299-81875321 CTTCGCCCCCCCGAGGGCCGCGG - Exonic
1072059740 10:91798476-91798498 CTCCGCCGCCGCGGGGCAGCCGG + Exonic
1073460218 10:103661654-103661676 CCTCTCCCGCCCGAGGGAGCAGG - Intronic
1075398075 10:122142200-122142222 CTGTGGAGCCCCGAGGGAGCAGG + Intronic
1075541599 10:123318569-123318591 CTTCCTGGCCCCTAGGGAGCAGG + Intergenic
1076948727 10:133667510-133667532 CATCGCCGCCCGGGAGGAGCTGG + Exonic
1076949711 10:133670809-133670831 CATCGCCGCCCGGGAGGAGCTGG + Intronic
1076950695 10:133674108-133674130 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076951685 10:133677418-133677440 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076952674 10:133680728-133680750 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076953658 10:133684027-133684049 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076955631 10:133743689-133743711 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076956621 10:133746999-133747021 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076957608 10:133750308-133750330 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076958593 10:133753607-133753629 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076959582 10:133756917-133756939 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076960566 10:133760216-133760238 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1084198559 11:67540596-67540618 CTTGGCCTCCCCATGGGAGCAGG + Intergenic
1091718416 12:2795540-2795562 CTCCGCCGCCCCGCGCGCGCCGG - Intronic
1096475595 12:51907238-51907260 ATCCGCCTCCCCGAGGGGGCGGG - Intronic
1097166018 12:57087282-57087304 CAGCGCCGCCCCAAGGGGGCCGG + Intronic
1099128282 12:78794167-78794189 GTCCGCCGCCCCGAGGGCTCCGG + Intergenic
1101144798 12:101830874-101830896 CTCCGCCGCGCCGAGGGCGTGGG - Exonic
1101871084 12:108566111-108566133 CTTTGCTGCCCCAAGGGACCAGG + Intronic
1103942037 12:124506429-124506451 CTTCGCCGTGGCGGGGGAGCAGG - Intronic
1113927989 13:113951805-113951827 CTACGACGCCCAGAGGGAACGGG + Intergenic
1118493128 14:66281180-66281202 GTTCGCGGCCTAGAGGGAGCTGG - Intergenic
1118637547 14:67761548-67761570 CTTTGCCACCCTGAGGGAACTGG - Exonic
1122975366 14:105168667-105168689 CGTCGCCGCCGGGTGGGAGCCGG - Exonic
1125520278 15:40344577-40344599 GTACGCAGCCCTGAGGGAGCCGG + Intergenic
1127841194 15:62833593-62833615 CTCAGCAGCCCAGAGGGAGCTGG + Exonic
1128149849 15:65355898-65355920 CTCCGCCGCCGCGAGTGCGCCGG - Intronic
1129162027 15:73752587-73752609 CTACCCCGCCCGGAGTGAGCTGG + Exonic
1129455202 15:75673101-75673123 CTGCCCTGCCCCCAGGGAGCTGG - Intergenic
1132321109 15:100926360-100926382 CTTCGCAGCCCTGAGGGACGAGG + Intronic
1132632921 16:928587-928609 CTTCACTGCCCTGAGGGAGCAGG + Intronic
1133272041 16:4615001-4615023 CTTCGCGTCCCCTAGGGTGCCGG - Intronic
1133286926 16:4694784-4694806 CTGCACTGCTCCGAGGGAGCTGG + Intronic
1134684376 16:16148432-16148454 CTGGGGCGCCCCCAGGGAGCTGG + Intergenic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1137285796 16:47014673-47014695 CTAGGCCACCCCGAGGGAGGGGG - Intergenic
1141683377 16:85556637-85556659 CTCCGCCGCCGCGGCGGAGCCGG - Intergenic
1142675914 17:1513260-1513282 CTTCGCCTTTCTGAGGGAGCTGG - Intronic
1142762374 17:2050106-2050128 CCTCGCAGCCCCTAGGGACCCGG + Intergenic
1145991319 17:29080858-29080880 CTTCACCTCCCTGAGCGAGCGGG - Intronic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1149038241 17:52158369-52158391 CTTCCCCGCCCCCCGGAAGCAGG - Exonic
1152575131 17:81136561-81136583 CTTCCCCGCACTGAGGCAGCTGG + Intronic
1154125636 18:11689716-11689738 CTTCGCCGCCCCGAGGGAGCAGG - Exonic
1154333391 18:13447959-13447981 CTTGGCCTCCCCCAGGAAGCAGG - Intronic
1160992354 19:1864866-1864888 CCCCGCCGCCCCGCCGGAGCTGG - Intergenic
1161421951 19:4180885-4180907 CTTCGACCCCCCGGAGGAGCTGG - Exonic
1162975748 19:14206393-14206415 CTCCGCGGCCCCGACGGAGGCGG + Intergenic
1163158208 19:15450071-15450093 CCTCGCCGCCCCGGGGGGGGCGG + Intergenic
1163795146 19:19333705-19333727 CTTCTCCGCCCAAAGGGAGGAGG + Intronic
1165779893 19:38426168-38426190 CTTCTCAGCCCCTAGGGAGCTGG + Exonic
1166090610 19:40506319-40506341 CATTGCCGCCCAGAGCGAGCGGG + Exonic
925927046 2:8678255-8678277 CCTCTCCGCCCTGGGGGAGCCGG - Intergenic
934993338 2:98936377-98936399 CTTGGACGCCCCGCGGGAGGCGG + Intergenic
941905021 2:170712070-170712092 CATCTCCGCCCCGAGGCAGGAGG + Intergenic
942178396 2:173355894-173355916 AGTCGCCGCCCCGGTGGAGCTGG + Intronic
942276408 2:174326839-174326861 CTTCGCCGACCTGGGGGAGGCGG - Intergenic
945032955 2:205682311-205682333 CGTCGCCGCCCCGCCCGAGCTGG + Intronic
1173005640 20:39137763-39137785 CTTCCCAGCCCCAAGGGAGCTGG - Intergenic
1174607038 20:51768459-51768481 CCGCGCCGCCCCGGGGGAGGAGG + Exonic
1175402859 20:58710538-58710560 CTTGGCCGCCCTGGGGGACCAGG + Intronic
1176375731 21:6086127-6086149 TCTCTCCTCCCCGAGGGAGCCGG - Intergenic
1176549076 21:8213727-8213749 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1176556970 21:8257947-8257969 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1176568008 21:8396765-8396787 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1176575912 21:8440984-8441006 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1179605715 21:42514027-42514049 CTGCGGCGCCCTCAGGGAGCCGG + Exonic
1179747743 21:43452117-43452139 TCTCTCCTCCCCGAGGGAGCCGG + Intergenic
1180614811 22:17120359-17120381 CTGCGCCGCCCCGACGGCCCCGG + Exonic
1183578217 22:38706023-38706045 CCTGGCCGCCCCCGGGGAGCTGG - Exonic
1184730472 22:46368688-46368710 CTTCGAGGCCCCAAAGGAGCAGG - Intronic
1185395206 22:50583173-50583195 CGTCTCTGCCCCGTGGGAGCCGG + Intronic
1203253963 22_KI270733v1_random:130042-130064 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1203262019 22_KI270733v1_random:175121-175143 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
950168026 3:10816206-10816228 CGCCGCCGCCCCGGGCGAGCTGG - Exonic
953007435 3:38991333-38991355 TTCCTCCGCCCAGAGGGAGCTGG + Intergenic
954333650 3:49903885-49903907 CTCAGCCGACCCGAGGGCGCCGG + Intronic
955161393 3:56468188-56468210 CACGGGCGCCCCGAGGGAGCCGG + Intronic
968044975 3:195618897-195618919 AGTGGCAGCCCCGAGGGAGCTGG + Intergenic
968060759 3:195724949-195724971 AGTGGCAGCCCCGAGGGAGCTGG + Exonic
970425076 4:15938432-15938454 CCACGCCCCTCCGAGGGAGCCGG + Exonic
973894183 4:55395932-55395954 CTGGGCCGCGCCGAGGCAGCTGG + Intergenic
983998256 4:174211982-174212004 ATTCGCTGACGCGAGGGAGCTGG - Intergenic
985446191 4:190022284-190022306 CATCGCCGCCCGGGAGGAGCTGG - Intergenic
985452181 4:190068294-190068316 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
985453165 4:190071591-190071613 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985454155 4:190074884-190074906 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985455143 4:190078177-190078199 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985456131 4:190081477-190081499 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985457115 4:190084771-190084793 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
985458102 4:190088064-190088086 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985459091 4:190091364-190091386 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985463344 4:190174133-190174155 CATCGCCGCCCGGGAGGAGCTGG + Exonic
1004562070 6:16760831-16760853 CTGCGCCACCCGGAGGGAGGAGG + Intronic
1015965466 6:138692706-138692728 CTGCGCCGGCCCGAGGCGGCGGG - Intergenic
1019898223 7:3999555-3999577 CTCCCCCGCCCCGAGGCACCAGG - Intronic
1023382649 7:39623788-39623810 GTCCGCCGCCCCGAGGGCTCCGG - Exonic
1025015448 7:55435572-55435594 GTACGCAGCCCCGAGTGAGCCGG + Intergenic
1025089742 7:56052067-56052089 CTGCGCAGCCCCGAGGCGGCGGG - Intronic
1025901903 7:65751359-65751381 CTGCGGAGCCCCGAGGCAGCGGG - Intergenic
1032239428 7:130149511-130149533 CCCGGCCGCCCCGGGGGAGCAGG - Intergenic
1034429797 7:151035569-151035591 CTTCGCAGCCCCTAGGGAGTGGG - Exonic
1036802523 8:11802946-11802968 CTTCCCCGCCCCGGGCAAGCAGG - Intronic
1037512997 8:19602609-19602631 CTTCACGCCCCCCAGGGAGCGGG - Intronic
1041689889 8:60678665-60678687 CGGCGCGGCCCGGAGGGAGCTGG + Intergenic
1057921734 9:99104236-99104258 CCCCTCCGCCCCGCGGGAGCTGG + Intronic
1058885954 9:109321057-109321079 CGGCGCAGCCCCGAGGGAGGAGG - Intergenic
1061092270 9:128433431-128433453 CTTCCCCGCCCCCAGAGAGTTGG + Intronic
1061162789 9:128905056-128905078 CTTAGCCTCCCCCAGGTAGCTGG - Intronic
1061828441 9:133275546-133275568 CCCCGCCTCCCCGGGGGAGCAGG - Intergenic
1061862553 9:133475492-133475514 CGTCCCTGCCCCGAGAGAGCAGG + Exonic
1062500814 9:136851271-136851293 CTTGGCCAGCCCGAGGGACCAGG - Intronic
1203470363 Un_GL000220v1:113186-113208 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1203478184 Un_GL000220v1:157158-157180 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1187464469 X:19515211-19515233 GCTCGCCGCCCCGAGGGCCCCGG + Exonic
1200144407 X:153919100-153919122 CTTCCCAGCCCCGAGGCACCAGG + Intronic
1200147549 X:153934564-153934586 CTGCCCAGCCCCGAGGGAGCGGG - Intronic